rs1800092968
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_019101.3(APOM):c.261_269+28delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC(p.Ile88_Met90del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change. The variant allele was found at a frequency of 0.00000248 in 1,613,824 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_019101.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_019101.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APOM | MANE Select | c.261_269+28delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC | p.Ile88_Met90del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 2 of 6 | NP_061974.2 | |||
| APOM | c.45_53+28delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC | p.Ile16_Met18del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 2 of 6 | NP_001243098.1 | O95445-2 | |||
| APOM | n.295_310+21delCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATCAC | splice_donor splice_region intron non_coding_transcript_exon | Exon 2 of 6 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APOM | TSL:1 MANE Select | c.259_269+26delACCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATC | p.Thr87AsnfsTer6 | frameshift splice_donor splice_region intron | Exon 2 of 6 | ENSP00000365081.3 | O95445-1 | ||
| APOM | TSL:1 | c.43_53+26delACCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATC | p.Thr15AsnfsTer6 | frameshift splice_donor splice_region intron | Exon 2 of 6 | ENSP00000365085.4 | O95445-2 | ||
| APOM | TSL:2 | c.43_53+26delACCATCCGCATGTGAGTGGTAAGGAGGCAGAAGCATC | p.Thr15AsnfsTer6 | frameshift splice_donor splice_region intron | Exon 2 of 5 | ENSP00000365083.2 | Q5SRP5 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152198Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 0.00000205 AC: 3AN: 1461626Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 727142 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152198Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74362 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at