NM_020435.4:c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC

Variant names:

• chr1-228158658-CCGCCGCGGCCCCCCGGCCTCCGCCCCCGCCCCCG-C
• rs796065028
• NM_020435.4:c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The NM_020435.4(GJC2):​c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC​(p.Pro305ArgfsTer155) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000884 in 1,357,480 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P305P) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000088 (0 hom.)
• Consequence: GJC2 NM_020435.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.24
• Publications: 0 publications found

Genes affected

GJC2 (HGNC:17494): (gap junction protein gamma 2) This gene encodes a gap junction protein. Gap junction proteins are members of a large family of homologous connexins and comprise 4 transmembrane, 2 extracellular, and 3 cytoplasmic domains. This gene plays a key role in central myelination and is involved in peripheral myelination in humans. Defects in this gene are the cause of autosomal recessive Pelizaeus-Merzbacher-like disease-1. [provided by RefSeq, Jul 2008]

GJC2 Gene-Disease associations (from GenCC):

• hypomyelinating leukodystrophy 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
• lymphatic malformation 3

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• hereditary spastic paraplegia 44

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
• lymphatic malformation

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 14 pathogenic variants in the truncated region.
• PP5: Variant 1-228158658-CCGCCGCGGCCCCCCGGCCTCCGCCCCCGCCCCCG-C is Pathogenic according to our data. Variant chr1-228158658-CCGCCGCGGCCCCCCGGCCTCCGCCCCCGCCCCCG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 2076.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020435.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJC2	NM_020435.4	MANE Select	c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC	p.Pro305ArgfsTer155	frameshift	Exon 2 of 2	NP_065168.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJC2	ENST00000366714.3	TSL:1 MANE Select	c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC	p.Pro305ArgfsTer155	frameshift	Exon 2 of 2	ENSP00000355675.2	Q5T442
	GJC2	ENST00000886860.1		c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC	p.Pro305ArgfsTer155	frameshift	Exon 2 of 2	ENSP00000556919.1
	GJC2	ENST00000963922.1		c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC	p.Pro305ArgfsTer155	frameshift	Exon 2 of 2	ENSP00000633981.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000569 AC: 1 AN: 175672 AF XY: 0.0000102

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000884 AC: 12 AN: 1357480 Hom.: 0 AF XY: 0.0000119 AC XY: 8 AN XY: 673716

African (AFR) AF: 0.00 AC: 0 AN: 29322

American (AMR) AF: 0.00 AC: 0 AN: 37220

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22860

East Asian (EAS) AF: 0.00 AC: 0 AN: 32808

South Asian (SAS) AF: 0.000124 AC: 10 AN: 80698

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 39014

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4738

European-Non Finnish (NFE) AF: 0.00000189 AC: 2 AN: 1056082

Other (OTH) AF: 0.00 AC: 0 AN: 54738

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Hypomyelinating leukodystrophy 2 (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=49/151	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs796065028; hg19: chr1-228346359;