rs796065028

Positions:

• chr1-228158658-CCGCCGCGGCCCCCCGGCCTCCGCCCCCGCCCCCG-C

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The NM_020435.4(GJC2):​c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC​(p.Pro305fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000884 in 1,357,480 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P305P) has been classified as Uncertain significance.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000088 (0 hom.)
• Consequence: GJC2 NM_020435.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.24

Genes affected

GJC2 (HGNC:17494): (gap junction protein gamma 2) This gene encodes a gap junction protein. Gap junction proteins are members of a large family of homologous connexins and comprise 4 transmembrane, 2 extracellular, and 3 cytoplasmic domains. This gene plays a key role in central myelination and is involved in peripheral myelination in humans. Defects in this gene are the cause of autosomal recessive Pelizaeus-Merzbacher-like disease-1. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 6 pathogenic variants in the truncated region.
• PP5: Variant 1-228158658-CCGCCGCGGCCCCCCGGCCTCCGCCCCCGCCCCCG-C is Pathogenic according to our data. Variant chr1-228158658-CCGCCGCGGCCCCCCGGCCTCCGCCCCCGCCCCCG-C is described in ClinVar as [Pathogenic]. Clinvar id is 2076.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr1-228158658-CCGCCGCGGCCCCCCGGCCTCCGCCCCCGCCCCCG-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
GJC2	NM_020435.4	c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC	p.Pro305fs	frameshift_variant	2/2	ENST00000366714.3	NP_065168.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
GJC2	ENST00000366714.3	c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC	p.Pro305fs	frameshift_variant	2/2	1	NM_020435.4	ENSP00000355675.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.00000569 AC: 1 AN: 175672 Hom.: 0 AF XY: 0.0000102 AC XY: 1 AN XY: 98370

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.0000398

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000884 AC: 12 AN: 1357480 Hom.: 0 AF XY: 0.0000119 AC XY: 8 AN XY: 673716

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000124

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000189

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Hypomyelinating leukodystrophy 2 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jan 01, 2007

- -

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Revvity Omics, Revvity

Mar 11, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs796065028; hg19: chr1-228346359;