rs796065028
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_StrongPP5_Moderate
The NM_020435.4(GJC2):c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC(p.Pro305ArgfsTer155) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000884 in 1,357,480 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P305P) has been classified as Likely benign.
Frequency
Consequence
NM_020435.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- hypomyelinating leukodystrophy 2Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
- lymphatic malformation 3Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- hereditary spastic paraplegia 44Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
- lymphatic malformationInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_020435.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GJC2 | TSL:1 MANE Select | c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC | p.Pro305ArgfsTer155 | frameshift | Exon 2 of 2 | ENSP00000355675.2 | Q5T442 | ||
| GJC2 | c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC | p.Pro305ArgfsTer155 | frameshift | Exon 2 of 2 | ENSP00000556919.1 | ||||
| GJC2 | c.914_947delCGGCCTCCGCCCCCGCCCCCGCGCCGCGGCCCCC | p.Pro305ArgfsTer155 | frameshift | Exon 2 of 2 | ENSP00000633981.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.00000569 AC: 1AN: 175672 AF XY: 0.0000102 show subpopulations
GnomAD4 exome AF: 0.00000884 AC: 12AN: 1357480Hom.: 0 AF XY: 0.0000119 AC XY: 8AN XY: 673716 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.