NM_020988.3:c.572_592delCATTCAAGAACCTCCACTTCA
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP3PP5
The NM_020988.3(GNAO1):c.572_592delCATTCAAGAACCTCCACTTCA(p.Thr191_Phe197del) variant causes a disruptive inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_020988.3 disruptive_inframe_deletion, splice_region
Scores
Clinical Significance
Conservation
Publications
- developmental and epileptic encephalopathy, 17Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
- genetic developmental and epileptic encephalopathyInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- movement disorderInheritance: AD Classification: DEFINITIVE Submitted by: Illumina, ClinGen
- neurodevelopmental disorder with involuntary movementsInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_020988.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GNAO1 | MANE Select | c.572_592delCATTCAAGAACCTCCACTTCA | p.Thr191_Phe197del | disruptive_inframe_deletion splice_region | Exon 5 of 9 | NP_066268.1 | P09471-1 | ||
| GNAO1 | c.572_592delCATTCAAGAACCTCCACTTCA | p.Thr191_Phe197del | disruptive_inframe_deletion splice_region | Exon 5 of 8 | NP_620073.2 | P09471-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GNAO1 | TSL:1 MANE Select | c.572_592delCATTCAAGAACCTCCACTTCA | p.Thr191_Phe197del | disruptive_inframe_deletion splice_region | Exon 5 of 9 | ENSP00000262493.6 | P09471-1 | ||
| GNAO1 | TSL:1 | c.572_592delCATTCAAGAACCTCCACTTCA | p.Thr191_Phe197del | disruptive_inframe_deletion splice_region | Exon 5 of 8 | ENSP00000262494.7 | P09471-2 | ||
| GNAO1 | TSL:1 | c.572_592delCATTCAAGAACCTCCACTTCA | p.Thr191_Phe197del | disruptive_inframe_deletion splice_region | Exon 5 of 8 | ENSP00000491223.1 | P09471-1 |
Frequencies
GnomAD3 genomes Cov.: 35
GnomAD4 genome Cov.: 35
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.