rs587777056

Positions:

• chr16-56334827-CCCACTTCACATTCAAGAACCT-C

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_020988.3(GNAO1):​c.572_592delCATTCAAGAACCTCCACTTCA​(p.Thr191_Phe197del) variant causes a disruptive inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 35)
• Consequence: GNAO1 NM_020988.3 disruptive_inframe_deletion, splice_region
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.27

Genes affected

GNAO1 (HGNC:4389): (G protein subunit alpha o1) The protein encoded by this gene represents the alpha subunit of the Go heterotrimeric G-protein signal-transducing complex. Defects in this gene are a cause of early-onset epileptic encephalopathy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_020988.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 16-56334827-CCCACTTCACATTCAAGAACCT-C is Pathogenic according to our data. Variant chr16-56334827-CCCACTTCACATTCAAGAACCT-C is described in ClinVar as [Pathogenic]. Clinvar id is 66114.Status of the report is no_assertion_criteria_provided, 0 stars. Variant chr16-56334827-CCCACTTCACATTCAAGAACCT-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
GNAO1	NM_020988.3	c.572_592delCATTCAAGAACCTCCACTTCA	p.Thr191_Phe197del	disruptive_inframe_deletion, splice_region_variant	5/9	ENST00000262493.12	NP_066268.1
GNAO1	NM_138736.3	c.572_592delCATTCAAGAACCTCCACTTCA	p.Thr191_Phe197del	disruptive_inframe_deletion, splice_region_variant	5/8		NP_620073.2
GNAO1	XM_011523003.4	c.446_466delCATTCAAGAACCTCCACTTCA	p.Thr149_Phe155del	disruptive_inframe_deletion, splice_region_variant	5/9		XP_011521305.1
GNAO1	XR_007064866.1	n.1319_1339delCATTCAAGAACCTCCACTTCA		splice_region_variant, non_coding_transcript_exon_variant	5/9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
GNAO1	ENST00000262493.12	c.572_592delCATTCAAGAACCTCCACTTCA	p.Thr191_Phe197del	disruptive_inframe_deletion, splice_region_variant	5/9	1	NM_020988.3	ENSP00000262493.6

Frequencies

GnomAD3 genomes Cov.: 35

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 35

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Developmental and epileptic encephalopathy, 17 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Sep 05, 2013

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587777056; hg19: chr16-56368739;