NM_021072.4:c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG

Variant names:

• chr5-45695878-G-GCCGCCGCCGCCGCCACCGCCGCCA
• rs1554040132
• NM_021072.4:c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_021072.4(HCN1):​c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG​(p.Gly65_Gly72dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G72G) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000015 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: HCN1 NM_021072.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.91
• Publications: 0 publications found

Genes affected

HCN1 (HGNC:4845): (hyperpolarization activated cyclic nucleotide gated potassium channel 1) The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]

HCN1 Gene-Disease associations (from GenCC):

• developmental and epileptic encephalopathy, 24

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• generalized epilepsy with febrile seizures plus

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• generalized epilepsy with febrile seizures plus, type 10

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• undetermined early-onset epileptic encephalopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_021072.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HCN1	NM_021072.4	c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG	p.Gly65_Gly72dup	disruptive_inframe_insertion	Exon 1 of 8	ENST00000303230.6	NP_066550.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HCN1	ENST00000303230.6	c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG	p.Gly65_Gly72dup	disruptive_inframe_insertion	Exon 1 of 8	1	NM_021072.4	ENSP00000307342.4
HCN1	ENST00000673735.1	c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG	p.Gly65_Gly72dup	disruptive_inframe_insertion	Exon 1 of 9			ENSP00000501107.1
HCN1	ENST00000634658.1	c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG	p.Gly65_Gly72dup	disruptive_inframe_insertion	Exon 1 of 2	3		ENSP00000489134.1
HCN1	ENST00000638054.1	n.-177_-154dupTGGCGGCGGTGGCGGCGGCGGCGG		upstream_gene_variant		5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000146 AC: 2 AN: 1374006 Hom.: 0 Cov.: 33 AF XY: 0.00000294 AC XY: 2 AN XY: 679682

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 30632

American (AMR) AF: 0.00 AC: 0 AN: 33550

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24344

East Asian (EAS) AF: 0.00 AC: 0 AN: 36268

South Asian (SAS) AF: 0.0000127 AC: 1 AN: 78858

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 38074

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5110

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1070100

Other (OTH) AF: 0.0000175 AC: 1 AN: 57070

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000000983081), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Developmental and epileptic encephalopathy Uncertain:1

Aug 09, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.192_215dup24, results in the insertion of 8 amino acid(s) of the HCN1 protein (p.Gly67_Gly74dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with HCN1-related conditions. ClinVar contains an entry for this variant (Variation ID: 461367). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9
Mutation Taster		=74/26	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554040132; hg19: chr5-45695980;