rs1554040132

Variant names:

• chr5-45695878-G-GCCGCCGCCGCCGCCACCGCCGCCA
• rs1554040132
• NM_021072.4:c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_021072.4(HCN1):​c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG​(p.Gly65_Gly72dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G72G) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000015 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: HCN1 NM_021072.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.91
• Publications: 0 publications found

Genes affected

HCN1 (HGNC:4845): (hyperpolarization activated cyclic nucleotide gated potassium channel 1) The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]

HCN1 Gene-Disease associations (from GenCC):

• developmental and epileptic encephalopathy, 24

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• generalized epilepsy with febrile seizures plus

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• generalized epilepsy with febrile seizures plus, type 10

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• undetermined early-onset epileptic encephalopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_021072.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_021072.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HCN1	NM_021072.4	MANE Select	c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG	p.Gly65_Gly72dup	disruptive_inframe_insertion	Exon 1 of 8	NP_066550.2	O60741

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HCN1	ENST00000303230.6	TSL:1 MANE Select	c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG	p.Gly65_Gly72dup	disruptive_inframe_insertion	Exon 1 of 8	ENSP00000307342.4	O60741
	HCN1	ENST00000947598.1		c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG	p.Gly65_Gly72dup	disruptive_inframe_insertion	Exon 1 of 8	ENSP00000617657.1
	HCN1	ENST00000673735.1		c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG	p.Gly65_Gly72dup	disruptive_inframe_insertion	Exon 1 of 9	ENSP00000501107.1	A0A669KB45

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000146 AC: 2 AN: 1374006 Hom.: 0 Cov.: 33 AF XY: 0.00000294 AC XY: 2 AN XY: 679682

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 30632

American (AMR) AF: 0.00 AC: 0 AN: 33550

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24344

East Asian (EAS) AF: 0.00 AC: 0 AN: 36268

South Asian (SAS) AF: 0.0000127 AC: 1 AN: 78858

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 38074

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5110

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1070100

Other (OTH) AF: 0.0000175 AC: 1 AN: 57070

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000000983081), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Developmental and epileptic encephalopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9
Mutation Taster		=74/26	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554040132; hg19: chr5-45695980;