rs1554040132
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_021072.4(HCN1):c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG(p.Gly65_Gly72dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G72G) has been classified as Likely benign.
Frequency
Consequence
NM_021072.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- developmental and epileptic encephalopathy, 24Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
- generalized epilepsy with febrile seizures plusInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- generalized epilepsy with febrile seizures plus, type 10Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- undetermined early-onset epileptic encephalopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_021072.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HCN1 | TSL:1 MANE Select | c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG | p.Gly65_Gly72dup | disruptive_inframe_insertion | Exon 1 of 8 | ENSP00000307342.4 | O60741 | ||
| HCN1 | c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG | p.Gly65_Gly72dup | disruptive_inframe_insertion | Exon 1 of 8 | ENSP00000617657.1 | ||||
| HCN1 | c.192_215dupTGGCGGCGGTGGCGGCGGCGGCGG | p.Gly65_Gly72dup | disruptive_inframe_insertion | Exon 1 of 9 | ENSP00000501107.1 | A0A669KB45 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000146 AC: 2AN: 1374006Hom.: 0 Cov.: 33 AF XY: 0.00000294 AC XY: 2AN XY: 679682 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.