NM_021098.3:c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG

Variant names:

• chr16-1153321-C-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG
• rs1339556967
• NM_021098.3:c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_021098.3(CACNA1H):​c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000186 in 139,544 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.00019 (0 hom., cov: 21)
• Consequence: CACNA1H NM_021098.3 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.64
• Publications: 0 publications found

Genes affected

CACNA1H (HGNC:1395): (calcium voltage-gated channel subunit alpha1 H) This gene encodes a T-type member of the alpha-1 subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. The alpha-1 subunit has 24 transmembrane segments and forms the pore through which ions pass into the cell. There are multiple isoforms of each of the proteins in the complex, either encoded by different genes or the result of alternative splicing of transcripts. Alternate transcriptional splice variants, encoding different isoforms, have been characterized for the gene described here. Studies suggest certain mutations in this gene lead to childhood absence epilepsy (CAE). [provided by RefSeq, Jul 2008]

CACNA1H Gene-Disease associations (from GenCC):

• hyperaldosteronism, familial, type IV

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• childhood absence epilepsy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• epilepsy, childhood absence, susceptibility to, 6

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P
• epilepsy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.000186 (26/139544) while in subpopulation EAS AF = 0.000897 (4/4460). AF 95% confidence interval is 0.000306. There are 0 homozygotes in GnomAd4. There are 16 alleles in the male GnomAd4 subpopulation. Median coverage is 21. This position passed quality control check.
• BS2: High AC in GnomAd4 at 26 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_021098.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1H	NM_021098.3	MANE Select	c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 35	NP_066921.2	O95180-1
	CACNA1H	NM_001005407.2		c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 34	NP_001005407.1	O95180-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1H	ENST00000348261.11	TSL:1 MANE Select	c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 35	ENSP00000334198.7	O95180-1
	CACNA1H	ENST00000569107.6	TSL:1	c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 34	ENSP00000454990.2	H3BNT0
	CACNA1H	ENST00000711493.1		c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 34	ENSP00000518778.1	A0AAA9YHG8

Frequencies

GnomAD3 genomes AF: 0.000186 AC: 26 AN: 139540 Hom.: 0 Cov.: 21

Gnomad AFR AF: 0.000467

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000698

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000894

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000129

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000314

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 0

GnomAD4 genome AF: 0.000186 AC: 26 AN: 139544 Hom.: 0 Cov.: 21 AF XY: 0.000236 AC XY: 16 AN XY: 67840

African (AFR) AF: 0.000467 AC: 18 AN: 38574

American (AMR) AF: 0.0000697 AC: 1 AN: 14340

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3344

East Asian (EAS) AF: 0.000897 AC: 4 AN: 4460

South Asian (SAS) AF: 0.00 AC: 0 AN: 4354

European-Finnish (FIN) AF: 0.000129 AC: 1 AN: 7770

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 244

European-Non Finnish (NFE) AF: 0.0000314 AC: 2 AN: 63646

Other (OTH) AF: 0.00 AC: 0 AN: 1940

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1339556967; hg19: chr16-1203321;