rs1339556967

Variant names:

• chr16-1153321-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG-C
• rs1339556967
• NM_021098.3:c.-125_-92delGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG

Your query was ambiguous. Multiple possible variants found:

• chr16-1153321-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG-C
• chr16-1153321-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_021098.3(CACNA1H):​c.-125_-92delGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.163 in 139,872 control chromosomes in the GnomAD database, including 2,056 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.16 (2053 hom., cov: 21)
  • Exomes 𝑓: 0.092 (3 hom.)
• Consequence: CACNA1H NM_021098.3 5_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 2.12
• Publications: 0 publications found

Genes affected

CACNA1H (HGNC:1395): (calcium voltage-gated channel subunit alpha1 H) This gene encodes a T-type member of the alpha-1 subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. The alpha-1 subunit has 24 transmembrane segments and forms the pore through which ions pass into the cell. There are multiple isoforms of each of the proteins in the complex, either encoded by different genes or the result of alternative splicing of transcripts. Alternate transcriptional splice variants, encoding different isoforms, have been characterized for the gene described here. Studies suggest certain mutations in this gene lead to childhood absence epilepsy (CAE). [provided by RefSeq, Jul 2008]

CACNA1H Gene-Disease associations (from GenCC):

• hyperaldosteronism, familial, type IV

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• childhood absence epilepsy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• epilepsy, childhood absence, susceptibility to, 6

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P
• epilepsy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 16-1153321-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG-C is Benign according to our data. Variant chr16-1153321-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG-C is described in ClinVar as Benign. ClinVar VariationId is 1275909.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.2 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_021098.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1H	NM_021098.3	MANE Select	c.-125_-92delGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 35	NP_066921.2	O95180-1
	CACNA1H	NM_001005407.2		c.-125_-92delGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 34	NP_001005407.1	O95180-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1H	ENST00000348261.11	TSL:1 MANE Select	c.-125_-92delGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 35	ENSP00000334198.7	O95180-1
	CACNA1H	ENST00000569107.6	TSL:1	c.-125_-92delGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 34	ENSP00000454990.2	H3BNT0
	CACNA1H	ENST00000711493.1		c.-125_-92delGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR	Exon 1 of 34	ENSP00000518778.1	A0AAA9YHG8

Frequencies

GnomAD3 genomes AF: 0.163 AC: 22743 AN: 139256 Hom.: 2050 Cov.: 21

Gnomad AFR AF: 0.116

Gnomad AMI AF: 0.0321

Gnomad AMR AF: 0.155

Gnomad ASJ AF: 0.236

Gnomad EAS AF: 0.0734

Gnomad SAS AF: 0.116

Gnomad FIN AF: 0.152

Gnomad MID AF: 0.131

Gnomad NFE AF: 0.203

Gnomad OTH AF: 0.173

GnomAD4 exome AF: 0.0918 AC: 56 AN: 610 Hom.: 3 AF XY: 0.0972 AC XY: 28 AN XY: 288

African (AFR) AC: 0 AN: 0

American (AMR) AC: 0 AN: 0

Ashkenazi Jewish (ASJ) AC: 0 AN: 0

East Asian (EAS) AC: 0 AN: 0

South Asian (SAS) AF: 0.0908 AC: 55 AN: 606

European-Finnish (FIN) AC: 0 AN: 0

Middle Eastern (MID) AC: 0 AN: 0

European-Non Finnish (NFE) AC: 0 AN: 0

Other (OTH) AF: 0.250 AC: 1 AN: 4

GnomAD4 genome AF: 0.163 AC: 22744 AN: 139262 Hom.: 2053 Cov.: 21 AF XY: 0.158 AC XY: 10689 AN XY: 67706

African (AFR) AF: 0.116 AC: 4482 AN: 38500

American (AMR) AF: 0.154 AC: 2211 AN: 14326

Ashkenazi Jewish (ASJ) AF: 0.236 AC: 788 AN: 3342

East Asian (EAS) AF: 0.0734 AC: 327 AN: 4454

South Asian (SAS) AF: 0.118 AC: 512 AN: 4344

European-Finnish (FIN) AF: 0.152 AC: 1177 AN: 7754

Middle Eastern (MID) AF: 0.131 AC: 32 AN: 244

European-Non Finnish (NFE) AF: 0.202 AC: 12856 AN: 63488

Other (OTH) AF: 0.171 AC: 331 AN: 1938

Alfa AF: 0.146 Hom.: 232

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=299/1	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1339556967; hg19: chr16-1203321; COSMIC: COSV62006784; COSMIC: COSV62006784;