NM_024649.5:c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG

Variant names:

• chr11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A
• rs113994178
• NM_024649.5:c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_024649.5(BBS1):​c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG​(p.Met1fs) variant causes a frameshift, start lost change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BBS1 NM_024649.5 frameshift, start_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.91

Genes affected

BBS1 (HGNC:966): (Bardet-Biedl syndrome 1) Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]

ENSG00000256349 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 45 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A is Pathogenic according to our data. Variant chr11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A is described in ClinVar as [Pathogenic]. Clinvar id is 21708.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BBS1	NM_024649.5	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 17	ENST00000318312.12	NP_078925.3
BBS1	NM_024649.5	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG		5_prime_UTR_variant	Exon 1 of 17	ENST00000318312.12	NP_078925.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BBS1	ENST00000318312.12	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 17	1	NM_024649.5	ENSP00000317469.7
BBS1	ENST00000318312	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG		5_prime_UTR_variant	Exon 1 of 17	1	NM_024649.5	ENSP00000317469.7
ENSG00000256349	ENST00000419755.3	c.159-356_159-317delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG		intron_variant	Intron 1 of 16	2		ENSP00000398526.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Bardet-Biedl syndrome Pathogenic:2

Jun 13, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the BBS1 protein in which other variant(s) (p.Ser16Cys) have been observed in individuals with BBS1-related conditions (PMID: 31196119). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. ClinVar contains an entry for this variant (Variation ID: 21708). Disruption of the initiator codon has been observed in individual(s) with Bardet-Biedl syndrome (PMID: 12524598, 17980398). This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the BBS1 mRNA. The next in-frame methionine is located at codon 31. -

Oct 13, 2009

GeneReviews

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs113994178; hg19: chr11-66278116;