rs113994178

Variant names:

• chr11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A
• rs113994178
• NM_024649.5:c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PP5_Moderate

The NM_024649.5(BBS1):​c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG​(p.Met1fs) variant causes a frameshift, start lost change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BBS1 NM_024649.5 frameshift, start_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.91
• Publications: 2 publications found

Genes affected

BBS1 (HGNC:966): (Bardet-Biedl syndrome 1) Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]

BBS1 Gene-Disease associations (from GenCC):

• Bardet-Biedl syndrome 1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Myriad Women’s Health, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• ciliopathy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Bardet-Biedl syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000256349 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 171 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_024649.5 (BBS1) was described as [Pathogenic] in ClinVar
• PP5: Variant 11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A is Pathogenic according to our data. Variant chr11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 21708.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_024649.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BBS1	NM_024649.5	MANE Select	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG	p.Met1fs	frameshift start_lost	Exon 1 of 17	NP_078925.3
	BBS1	NM_024649.5	MANE Select	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG		5_prime_UTR	Exon 1 of 17	NP_078925.3

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BBS1	ENST00000318312.12	TSL:1 MANE Select	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG	p.Met1fs	frameshift start_lost	Exon 1 of 17	ENSP00000317469.7
	BBS1	ENST00000393994.4	TSL:1	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG	p.Met1fs	frameshift start_lost	Exon 1 of 13	ENSP00000377563.2
	BBS1	ENST00000529955.5	TSL:1	n.16_55delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG		non_coding_transcript_exon	Exon 1 of 16

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
2	-	-	Bardet-Biedl syndrome (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.9
Mutation Taster		=39/161	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs113994178; hg19: chr11-66278116;