rs113994178

Variant names:

• chr11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A
• rs113994178
• NM_024649.5:c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PP5_Moderate

The NM_024649.5(BBS1):​c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG​(p.Met1fs) variant causes a frameshift, start lost change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BBS1 NM_024649.5 frameshift, start_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.91
• Publications: 2 publications found

Genes affected

BBS1 (HGNC:966): (Bardet-Biedl syndrome 1) Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]

BBS1 Gene-Disease associations (from GenCC):

• Bardet-Biedl syndrome 1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Myriad Women’s Health, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• ciliopathy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Bardet-Biedl syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000256349 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 171 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_024649.5 (BBS1) was described as [Likely_pathogenic] in ClinVar as 1457144
• PP5: Variant 11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A is Pathogenic according to our data. Variant chr11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A is described in ClinVar as [Pathogenic]. Clinvar id is 21708.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BBS1	NM_024649.5	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 17	ENST00000318312.12	NP_078925.3
BBS1	NM_024649.5	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG		5_prime_UTR_variant	Exon 1 of 17	ENST00000318312.12	NP_078925.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BBS1	ENST00000318312.12	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 17	1	NM_024649.5	ENSP00000317469.7
BBS1	ENST00000318312.12	c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG		5_prime_UTR_variant	Exon 1 of 17	1	NM_024649.5	ENSP00000317469.7
ENSG00000256349	ENST00000419755.3	c.159-356_159-317delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG		intron_variant	Intron 1 of 16	2		ENSP00000398526.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Bardet-Biedl syndrome Pathogenic:2

Jun 13, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the BBS1 protein in which other variant(s) (p.Ser16Cys) have been observed in individuals with BBS1-related conditions (PMID: 31196119). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. ClinVar contains an entry for this variant (Variation ID: 21708). Disruption of the initiator codon has been observed in individual(s) with Bardet-Biedl syndrome (PMID: 12524598, 17980398). This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the BBS1 mRNA. The next in-frame methionine is located at codon 31. -

Oct 13, 2009

GeneReviews

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.9
Mutation Taster		=39/161	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs113994178; hg19: chr11-66278116;