NM_025216.3:c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC

Variant names:

• chr2-218880974-AGCCCGTCAGGGCCTGCGCGCCATGGGCAGC-A
• rs746813123
• NM_025216.3:c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PP5_Moderate

The NM_025216.3(WNT10A):​c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC​(p.Met1_His5del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000214 in 1,403,404 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: WNT10A NM_025216.3 start_lost, conservative_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.33
• Publications: 0 publications found

Genes affected

WNT10A (HGNC:13829): (Wnt family member 10A) The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]

WNT10A Gene-Disease associations (from GenCC):

• ectodermal dysplasia WNT10A related

  Inheritance: SD Classification: DEFINITIVE Submitted by: Illumina, ClinGen
• tooth agenesis, selective, 4

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• odonto-onycho-dermal dysplasia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• Schöpf-Schulz-Passarge syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• tooth agenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive hypohidrotic ectodermal dysplasia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000300702 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PS1: Another start lost variant in NM_025216.3 (WNT10A) was described as [Likely_pathogenic] in ClinVar
• PP5: Variant 2-218880974-AGCCCGTCAGGGCCTGCGCGCCATGGGCAGC-A is Pathogenic according to our data. Variant chr2-218880974-AGCCCGTCAGGGCCTGCGCGCCATGGGCAGC-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 1067133.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_025216.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WNT10A	NM_025216.3	MANE Select	c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC	p.Met1_His5del	start_lost conservative_inframe_deletion	Exon 1 of 4	NP_079492.2
	WNT10A	NM_025216.3	MANE Select	c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC		5_prime_UTR	Exon 1 of 4	NP_079492.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WNT10A	ENST00000258411.8	TSL:1 MANE Select	c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC	p.Met1_His5del	start_lost conservative_inframe_deletion	Exon 1 of 4	ENSP00000258411.3	Q9GZT5
	WNT10A	ENST00000258411.8	TSL:1 MANE Select	c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC		5_prime_UTR	Exon 1 of 4	ENSP00000258411.3	Q9GZT5
	WNT10A	ENST00000964557.1		c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC	p.Met1_His5del	start_lost conservative_inframe_deletion	Exon 1 of 6	ENSP00000634616.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.0000263 AC: 4 AN: 152178 AF XY: 0.0000241

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000155

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000214 AC: 3 AN: 1403404 Hom.: 0 AF XY: 0.00000289 AC XY: 2 AN XY: 692978

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 31936

American (AMR) AF: 0.0000813 AC: 3 AN: 36912

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25050

East Asian (EAS) AF: 0.00 AC: 0 AN: 36392

South Asian (SAS) AF: 0.00 AC: 0 AN: 80072

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 48198

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4944

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1081884

Other (OTH) AF: 0.00 AC: 0 AN: 58016

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0136242), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Odonto-onycho-dermal dysplasia;C1835492:Tooth agenesis, selective, 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs746813123; hg19: chr2-219745696;