chr2-218880974-AGCCCGTCAGGGCCTGCGCGCCATGGGCAGC-A

Variant names:

• chr2-218880974-AGCCCGTCAGGGCCTGCGCGCCATGGGCAGC-A
• rs746813123
• NM_025216.3:c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1 PS1_Moderate PM2 PP5_Moderate

The NM_025216.3(WNT10A):​c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC​(p.Met1_His5del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000214 in 1,403,404 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: WNT10A NM_025216.3 start_lost, conservative_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.33

Genes affected

WNT10A (HGNC:13829): (Wnt family member 10A) The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PS1: Another start lost variant in NM_025216.3 (WNT10A) was described as [Likely_pathogenic] in ClinVar as 1466056
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-218880974-AGCCCGTCAGGGCCTGCGCGCCATGGGCAGC-A is Pathogenic according to our data. Variant chr2-218880974-AGCCCGTCAGGGCCTGCGCGCCATGGGCAGC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1067133.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
WNT10A	NM_025216.3	c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC	p.Met1_His5del	start_lost, conservative_inframe_deletion	Exon 1 of 4	ENST00000258411.8	NP_079492.2
WNT10A	NM_025216.3	c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC		5_prime_UTR_variant	Exon 1 of 4	ENST00000258411.8	NP_079492.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
WNT10A	ENST00000258411.8	c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC	p.Met1_His5del	start_lost, conservative_inframe_deletion	Exon 1 of 4	1	NM_025216.3	ENSP00000258411.3
WNT10A	ENST00000258411	c.-17_13delGTCAGGGCCTGCGCGCCATGGGCAGCGCCC		5_prime_UTR_variant	Exon 1 of 4	1	NM_025216.3	ENSP00000258411.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.0000263 AC: 4 AN: 152178 Hom.: 0 AF XY: 0.0000241 AC XY: 2 AN XY: 83122

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000155

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000214 AC: 3 AN: 1403404 Hom.: 0 AF XY: 0.00000289 AC XY: 2 AN XY: 692978

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000813

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

Bravo AF: 0.00000756

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Odonto-onycho-dermal dysplasia;C1835492:Tooth agenesis, selective, 4 Pathogenic:1

Jan 29, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the WNT10A mRNA. The next in-frame methionine is located at codon 36. This variant is present in population databases (rs746813123, gnomAD 0.02%). Disruption of the initiator codon has been observed in individual(s) with clinical features of autosomal recessive ectodermal dysplasia (PMID: 23401279). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 1067133). This variant disrupts a region of the WNT10A protein in which other variant(s) (p.Leu29Arg) have been observed in individuals with WNT10A-related conditions (PMID: 23401279). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs746813123; hg19: chr2-219745696;