NM_025216.3:c.5_27delGCAGCGCCCACCCTCGCCCCTGG

Variant names:

• chr2-218880996-ATGGGCAGCGCCCACCCTCGCCCC-A
• NM_025216.3:c.5_27delGCAGCGCCCACCCTCGCCCCTGG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_025216.3(WNT10A):​c.5_27delGCAGCGCCCACCCTCGCCCCTGG​(p.Gly2AlafsTer34) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: WNT10A NM_025216.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.41
• Publications: 0 publications found

Genes affected

WNT10A (HGNC:13829): (Wnt family member 10A) The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]

WNT10A Gene-Disease associations (from GenCC):

• ectodermal dysplasia WNT10A related

  Inheritance: SD Classification: DEFINITIVE Submitted by: Illumina, ClinGen
• tooth agenesis, selective, 4

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• odonto-onycho-dermal dysplasia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• Schöpf-Schulz-Passarge syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• tooth agenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive hypohidrotic ectodermal dysplasia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000300702 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 113 pathogenic variants in the truncated region.
• PP5: Variant 2-218880996-ATGGGCAGCGCCCACCCTCGCCCC-A is Pathogenic according to our data. Variant chr2-218880996-ATGGGCAGCGCCCACCCTCGCCCC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 2937327.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_025216.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WNT10A	NM_025216.3	MANE Select	c.5_27delGCAGCGCCCACCCTCGCCCCTGG	p.Gly2AlafsTer34	frameshift	Exon 1 of 4	NP_079492.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WNT10A	ENST00000258411.8	TSL:1 MANE Select	c.5_27delGCAGCGCCCACCCTCGCCCCTGG	p.Gly2AlafsTer34	frameshift	Exon 1 of 4	ENSP00000258411.3	Q9GZT5
	WNT10A	ENST00000964557.1		c.5_27delGCAGCGCCCACCCTCGCCCCTGG	p.Gly2AlafsTer34	frameshift	Exon 1 of 6	ENSP00000634616.1
	WNT10A	ENST00000865256.1		c.5_27delGCAGCGCCCACCCTCGCCCCTGG	p.Gly2AlafsTer34	frameshift	Exon 1 of 4	ENSP00000535315.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Odonto-onycho-dermal dysplasia;C1835492:Tooth agenesis, selective, 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr2-219745718;