NM_025216.3:c.5_27delGCAGCGCCCACCCTCGCCCCTGG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_025216.3(WNT10A):​c.5_27delGCAGCGCCCACCCTCGCCCCTGG​(p.Gly2AlafsTer34) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

WNT10A
NM_025216.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 4.41

Publications

0 publications found
Variant links:
Genes affected
WNT10A (HGNC:13829): (Wnt family member 10A) The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]
WNT10A Gene-Disease associations (from GenCC):
  • ectodermal dysplasia WNT10A related
    Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen, Illumina
  • tooth agenesis, selective, 4
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • odonto-onycho-dermal dysplasia
    Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
  • Schöpf-Schulz-Passarge syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • tooth agenesis
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • autosomal recessive hypohidrotic ectodermal dysplasia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 112 pathogenic variants in the truncated region.
PP5
Variant 2-218880996-ATGGGCAGCGCCCACCCTCGCCCC-A is Pathogenic according to our data. Variant chr2-218880996-ATGGGCAGCGCCCACCCTCGCCCC-A is described in ClinVar as [Pathogenic]. Clinvar id is 2937327.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
WNT10ANM_025216.3 linkc.5_27delGCAGCGCCCACCCTCGCCCCTGG p.Gly2AlafsTer34 frameshift_variant Exon 1 of 4 ENST00000258411.8 NP_079492.2 Q9GZT5A0A2K8FR47
WNT10AXM_011511930.2 linkc.5_27delGCAGCGCCCACCCTCGCCCCTGG p.Gly2AlafsTer34 frameshift_variant Exon 1 of 3 XP_011510232.1
WNT10AXM_011511929.3 linkc.18-1161_18-1139delGCAGCGCCCACCCTCGCCCCTGG intron_variant Intron 2 of 4 XP_011510231.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
WNT10AENST00000258411.8 linkc.5_27delGCAGCGCCCACCCTCGCCCCTGG p.Gly2AlafsTer34 frameshift_variant Exon 1 of 4 1 NM_025216.3 ENSP00000258411.3 Q9GZT5
ENSG00000300702ENST00000773519.1 linkn.*149_*171delTGGGCAGCGCCCACCCTCGCCCC downstream_gene_variant

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Odonto-onycho-dermal dysplasia;C1835492:Tooth agenesis, selective, 4 Pathogenic:1
Dec 24, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with WNT10A-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gly2Alafs*34) in the WNT10A gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in WNT10A are known to be pathogenic (PMID: 17847007, 22581971, 25629078). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
4.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

hg19: chr2-219745718; API