chr2-218880996-ATGGGCAGCGCCCACCCTCGCCCC-A

Variant names:

• chr2-218880996-ATGGGCAGCGCCCACCCTCGCCCC-A
• NM_025216.3:c.5_27delGCAGCGCCCACCCTCGCCCCTGG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_025216.3(WNT10A):​c.5_27delGCAGCGCCCACCCTCGCCCCTGG​(p.Gly2AlafsTer34) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: WNT10A NM_025216.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.41
• Publications: 0 publications found

Genes affected

WNT10A (HGNC:13829): (Wnt family member 10A) The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]

WNT10A Gene-Disease associations (from GenCC):

• ectodermal dysplasia WNT10A related

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen, Illumina
• tooth agenesis, selective, 4

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• odonto-onycho-dermal dysplasia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
• Schöpf-Schulz-Passarge syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• tooth agenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive hypohidrotic ectodermal dysplasia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000300702 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 112 pathogenic variants in the truncated region.
• PP5: Variant 2-218880996-ATGGGCAGCGCCCACCCTCGCCCC-A is Pathogenic according to our data. Variant chr2-218880996-ATGGGCAGCGCCCACCCTCGCCCC-A is described in ClinVar as [Pathogenic]. Clinvar id is 2937327.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
WNT10A	NM_025216.3	c.5_27delGCAGCGCCCACCCTCGCCCCTGG	p.Gly2AlafsTer34	frameshift_variant	Exon 1 of 4	ENST00000258411.8	NP_079492.2
WNT10A	XM_011511930.2	c.5_27delGCAGCGCCCACCCTCGCCCCTGG	p.Gly2AlafsTer34	frameshift_variant	Exon 1 of 3		XP_011510232.1
WNT10A	XM_011511929.3	c.18-1161_18-1139delGCAGCGCCCACCCTCGCCCCTGG		intron_variant	Intron 2 of 4		XP_011510231.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
WNT10A	ENST00000258411.8	c.5_27delGCAGCGCCCACCCTCGCCCCTGG	p.Gly2AlafsTer34	frameshift_variant	Exon 1 of 4	1	NM_025216.3	ENSP00000258411.3
ENSG00000300702	ENST00000773519.1	n.*149_*171delTGGGCAGCGCCCACCCTCGCCCC		downstream_gene_variant

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Odonto-onycho-dermal dysplasia;C1835492:Tooth agenesis, selective, 4 Pathogenic:1

Dec 24, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with WNT10A-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Gly2Alafs*34) in the WNT10A gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in WNT10A are known to be pathogenic (PMID: 17847007, 22581971, 25629078). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr2-219745718;