NM_030665.4:c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr17-17793779-CCAGCAGCAGCAGCAGCAGCAGCAGCAG-C
• rs371983878
• NM_030665.4:c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_030665.4(RAI1):​c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln283_Gln291del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000391 in 1,278,812 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.000039 (0 hom.)
• Consequence: RAI1 NM_030665.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:2
• Conservation: PhyloP100: 4.86

Genes affected

RAI1 (HGNC:9834): (retinoic acid induced 1) This gene is located within the Smith-Magenis syndrome region on chromosome 17. It is highly similar to its mouse counterpart and is expressed at high levels mainly in neuronal tissues. The protein encoded by this gene includes a polymorphic polyglutamine tract in the N-terminal domain. Expression of the mouse counterpart in neurons is induced by retinoic acid. This gene is associated with both the severity of the phenotype and the response to medication in schizophrenic patients. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAdExome4 at 50 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RAI1	NM_030665.4	c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln283_Gln291del	disruptive_inframe_deletion	Exon 3 of 6	ENST00000353383.6	NP_109590.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RAI1	ENST00000353383.6	c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln283_Gln291del	disruptive_inframe_deletion	Exon 3 of 6	1	NM_030665.4	ENSP00000323074.4
RAI1	ENST00000395774.1	c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln283_Gln291del	disruptive_inframe_deletion	Exon 2 of 2	2		ENSP00000379120.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.0000391 AC: 50 AN: 1278812 Hom.: 0 AF XY: 0.0000411 AC XY: 26 AN XY: 632490

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000537

Gnomad4 SAS exome AF: 0.0000179

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000442

Gnomad4 OTH exome AF: 0.0000577

GnomAD4 genome Cov.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jan 19, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.846_872del, results in the deletion of 9 amino acid(s) of the RAI1 protein (p.Gln283_Gln291del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RAI1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

RAI1-related disorder Uncertain:1

Sep 28, 2024

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The RAI1 c.846_872del27 variant is predicted to result in an in-frame deletion (p.Gln283_Gln291del). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs371983878; hg19: chr17-17697093;