chr17-17793779-CCAGCAGCAGCAGCAGCAGCAGCAGCAG-C
Variant summary
Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2
The NM_030665.4(RAI1):c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln283_Gln291del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000391 in 1,278,812 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_030665.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -4 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RAI1 | ENST00000353383.6 | c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln283_Gln291del | disruptive_inframe_deletion | Exon 3 of 6 | 1 | NM_030665.4 | ENSP00000323074.4 | ||
RAI1 | ENST00000395774.1 | c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln283_Gln291del | disruptive_inframe_deletion | Exon 2 of 2 | 2 | ENSP00000379120.1 |
Frequencies
GnomAD3 genomes Cov.: 0
GnomAD4 exome AF: 0.0000391 AC: 50AN: 1278812Hom.: 0 AF XY: 0.0000411 AC XY: 26AN XY: 632490
GnomAD4 genome Cov.: 0
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant, c.846_872del, results in the deletion of 9 amino acid(s) of the RAI1 protein (p.Gln283_Gln291del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RAI1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
RAI1-related disorder Uncertain:1
The RAI1 c.846_872del27 variant is predicted to result in an in-frame deletion (p.Gln283_Gln291del). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at