NM_033380.3:c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG
Variant summary
The NM_033380.3(COL4A5):c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG(p.Ile706AsnfsTer48) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_033380.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Alport syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P, ClinGen
- X-linked Alport syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, Myriad Women's Health, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_033380.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | MANE Select | c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG | p.Ile706AsnfsTer48 | frameshift | Exon 27 of 53 | NP_203699.1 | P29400-2 | ||
| COL4A5 | c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG | p.Ile706AsnfsTer48 | frameshift | Exon 27 of 51 | NP_000486.1 | P29400-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | TSL:1 MANE Select | c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG | p.Ile706AsnfsTer48 | frameshift | Exon 27 of 53 | ENSP00000331902.7 | P29400-2 | ||
| COL4A5 | TSL:1 | c.886_938dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG | p.Ile314AsnfsTer48 | frameshift | Exon 11 of 20 | ENSP00000495685.1 | Q49AM6 | ||
| COL4A5 | c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG | p.Ile706AsnfsTer48 | frameshift | Exon 27 of 51 | ENSP00000619202.1 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 exome Cov.: 25
GnomAD4 genome Cov.: 23
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.