rs104886342

Variant names:

• chrX-108601902-G-GGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCT
• rs104886342
• NM_033380.3:c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_033380.3(COL4A5):​c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG​(p.Ile706AsnfsTer48) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 23)
• Consequence: COL4A5 NM_033380.3 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 9.26
• Publications: 2 publications found

Genes affected

COL4A5 (HGNC:2207): (collagen type IV alpha 5 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. Mutations in this gene are associated with X-linked Alport syndrome, also known as hereditary nephritis. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]

COL4A5 Gene-Disease associations (from GenCC):

• Alport syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen, G2P
• X-linked Alport syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Genomics England PanelApp, Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COL4A5	NM_033380.3	c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG	p.Ile706AsnfsTer48	frameshift_variant	Exon 27 of 53	ENST00000328300.11	NP_203699.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COL4A5	ENST00000328300.11	c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG	p.Ile706AsnfsTer48	frameshift_variant	Exon 27 of 53	1	NM_033380.3	ENSP00000331902.7
COL4A5	ENST00000483338.1	c.886_938dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG	p.Ile314AsnfsTer48	frameshift_variant	Exon 11 of 20	1		ENSP00000495685.1
COL4A5	ENST00000361603.7	c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG	p.Ile706AsnfsTer48	frameshift_variant	Exon 27 of 51	2		ENSP00000354505.2

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Cov.: 25

GnomAD4 genome Cov.: 23

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs104886342; hg19: chrX-107845132;