NM_130468.4:c.981_1000dupGTACCGGCCAGCCAGCCCCG
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_StrongPP5
The NM_130468.4(CHST14):c.981_1000dupGTACCGGCCAGCCAGCCCCG(p.Glu334GlyfsTer107) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_130468.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- Ehlers-Danlos syndrome, musculocontractural type 1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- Ehlers-Danlos syndrome, musculocontractural typeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| CHST14 | ENST00000306243.7 | c.981_1000dupGTACCGGCCAGCCAGCCCCG | p.Glu334GlyfsTer107 | frameshift_variant | Exon 1 of 1 | 6 | NM_130468.4 | ENSP00000307297.6 | ||
| CHST14 | ENST00000559991.1 | c.906_925dupGTACCGGCCAGCCAGCCCCG | p.Glu309GlyfsTer107 | frameshift_variant | Exon 2 of 2 | 5 | ENSP00000453882.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Ehlers-Danlos syndrome, musculocontractural type 1 Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at