rs1555410785

Variant names:

• chr15-40472192-T-TGGTACCGGCCAGCCAGCCCC
• rs1555410785
• NM_130468.4:c.981_1000dupGTACCGGCCAGCCAGCCCCG

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_Strong PM2 PP5

The NM_130468.4(CHST14):​c.981_1000dupGTACCGGCCAGCCAGCCCCG​(p.Glu334GlyfsTer107) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CHST14 NM_130468.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 6.81

Genes affected

CHST14 (HGNC:24464): (carbohydrate sulfotransferase 14) This gene encodes a member of the HNK-1 family of sulfotransferases. The encoded protein transfers sulfate to the C-4 hydroxyl of N-acetylgalactosamine residues in dermatan sulfate. Mutations in this gene have been associated with adducted thumb-clubfoot syndrome.[provided by RefSeq, Mar 2010]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.115 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 15-40472192-T-TGGTACCGGCCAGCCAGCCCC is Pathogenic according to our data. Variant chr15-40472192-T-TGGTACCGGCCAGCCAGCCCC is described in ClinVar as [Pathogenic]. Clinvar id is 18421.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CHST14	NM_130468.4	c.981_1000dupGTACCGGCCAGCCAGCCCCG	p.Glu334GlyfsTer107	frameshift_variant	Exon 1 of 1	ENST00000306243.7	NP_569735.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CHST14	ENST00000306243.7	c.981_1000dupGTACCGGCCAGCCAGCCCCG	p.Glu334GlyfsTer107	frameshift_variant	Exon 1 of 1	6	NM_130468.4	ENSP00000307297.6
CHST14	ENST00000559991.1	c.906_925dupGTACCGGCCAGCCAGCCCCG	p.Glu309GlyfsTer107	frameshift_variant	Exon 2 of 2	5		ENSP00000453882.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Ehlers-Danlos syndrome, musculocontractural type 1 Pathogenic:1

Nov 01, 2010

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555410785; hg19: chr15-40764391;