NM_133433.4:c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA

Variant names:

• chr5-37063828-AGAAGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCG-A
• rs727503771
• NM_133433.4:c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_133433.4(NIPBL):​c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA​(p.Glu2635GlnfsTer13) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: NIPBL NM_133433.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.60
• Publications: 0 publications found

Genes affected

NIPBL (HGNC:28862): (NIPBL cohesin loading factor) This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and cognitive disability. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

NIPBL Gene-Disease associations (from GenCC):

• Cornelia de Lange syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Cornelia de Lange syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 5-37063828-AGAAGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCG-A is Pathogenic according to our data. Variant chr5-37063828-AGAAGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCG-A is described in ClinVar as Pathogenic. ClinVar VariationId is 180195.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NIPBL	NM_133433.4	c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA	p.Glu2635GlnfsTer13	frameshift_variant	Exon 46 of 47	ENST00000282516.13	NP_597677.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NIPBL	ENST00000282516.13	c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA	p.Glu2635GlnfsTer13	frameshift_variant	Exon 46 of 47	1	NM_133433.4	ENSP00000282516.8

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Cornelia de Lange syndrome 1 Pathogenic:1

Dec 02, 2014

Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727503771; hg19: chr5-37063930;