NM_139058.3:c.335_368delCAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_139058.3(ARX):​c.335_368delCAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG​(p.Ala112GlyfsTer45) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A112A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 22)

Consequence

ARX
NM_139058.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 1.07

Publications

0 publications found
Variant links:
Genes affected
ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]
ARX Gene-Disease associations (from GenCC):
  • genetic developmental and epileptic encephalopathy
    Inheritance: XL, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • intellectual disability, X-linked, with or without seizures, ARX-related
    Inheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
  • Partington syndrome
    Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
  • X-linked complex neurodevelopmental disorder
    Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
  • X-linked lissencephaly with abnormal genitalia
    Inheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
  • infantile spasms
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • corpus callosum agenesis-abnormal genitalia syndrome
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • infantile epileptic-dyskinetic encephalopathy
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • non-syndromic X-linked intellectual disability
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • X-linked spasticity-intellectual disability-epilepsy syndrome
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant X-25013626-CCCGCGTGGACCCGCCGTGGCCGTGGCGGCCGCTG-C is Pathogenic according to our data. Variant chrX-25013626-CCCGCGTGGACCCGCCGTGGCCGTGGCGGCCGCTG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 157756.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ARXNM_139058.3 linkc.335_368delCAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG p.Ala112GlyfsTer45 frameshift_variant Exon 2 of 5 ENST00000379044.5 NP_620689.1 Q96QS3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ARXENST00000379044.5 linkc.335_368delCAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG p.Ala112GlyfsTer45 frameshift_variant Exon 2 of 5 1 NM_139058.3 ENSP00000368332.4 Q96QS3

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

X-linked lissencephaly with abnormal genitalia Pathogenic:1
Feb 08, 2013
Genetic Services Laboratory, University of Chicago
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
1.1
Mutation Taster
=6/194
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs587783199; hg19: chrX-25031743; API