rs587783199

Variant names:

• chrX-25013626-CCCGCGTGGACCCGCCGTGGCCGTGGCGGCCGCTG-C
• rs587783199
• NM_139058.3:c.335_368delCAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_139058.3(ARX):​c.335_368delCAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG​(p.Ala112GlyfsTer45) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A112A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: ARX NM_139058.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.07
• Publications: 0 publications found

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ARX Gene-Disease associations (from GenCC):

• genetic developmental and epileptic encephalopathy

  Inheritance: XL, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• intellectual disability, X-linked, with or without seizures, ARX-related

  Inheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
• Partington syndrome

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• X-linked lissencephaly with abnormal genitalia

  Inheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• infantile spasms

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• corpus callosum agenesis-abnormal genitalia syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• infantile epileptic-dyskinetic encephalopathy

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked spasticity-intellectual disability-epilepsy syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-25013626-CCCGCGTGGACCCGCCGTGGCCGTGGCGGCCGCTG-C is Pathogenic according to our data. Variant chrX-25013626-CCCGCGTGGACCCGCCGTGGCCGTGGCGGCCGCTG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 157756.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ARX	NM_139058.3	c.335_368delCAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG	p.Ala112GlyfsTer45	frameshift_variant	Exon 2 of 5	ENST00000379044.5	NP_620689.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ARX	ENST00000379044.5	c.335_368delCAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG	p.Ala112GlyfsTer45	frameshift_variant	Exon 2 of 5	1	NM_139058.3	ENSP00000368332.4

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

X-linked lissencephaly with abnormal genitalia Pathogenic:1

Feb 08, 2013

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1
Mutation Taster		=6/194	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587783199; hg19: chrX-25031743;