NM_183357.3:c.409_428dupGGCGGCTCGGCGGCGGCGGC

Variant names:

• chr3-123448117-A-AGCCGCCGCCGCCGAGCCGCC
• rs1553751262
• NM_183357.3:c.409_428dupGGCGGCTCGGCGGCGGCGGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_183357.3(ADCY5):​c.409_428dupGGCGGCTCGGCGGCGGCGGC​(p.Ser145AlafsTer100) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ADCY5 NM_183357.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.34
• Publications: 0 publications found

Genes affected

ADCY5 (HGNC:236): (adenylate cyclase 5) This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]

ADCY5 Gene-Disease associations (from GenCC):

• dyskinesia with orofacial involvement, autosomal dominant

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• neurodevelopmental disorder

  Inheritance: AD Classification: STRONG Submitted by: G2P
• neurodevelopmental disorder with hyperkinetic movements and dyskinesia

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• familial dyskinesia and facial myokymia

  Inheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
• choreatic disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 3-123448117-A-AGCCGCCGCCGCCGAGCCGCC is Pathogenic according to our data. Variant chr3-123448117-A-AGCCGCCGCCGCCGAGCCGCC is described in ClinVar as Pathogenic. ClinVar VariationId is 985504.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_183357.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ADCY5	NM_183357.3	MANE Select	c.409_428dupGGCGGCTCGGCGGCGGCGGC	p.Ser145AlafsTer100	frameshift	Exon 1 of 21	NP_899200.1
	ADCY5	NM_001378259.1		c.409_428dupGGCGGCTCGGCGGCGGCGGC	p.Ser145AlafsTer100	frameshift	Exon 1 of 22	NP_001365188.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ADCY5	ENST00000462833.6	TSL:1 MANE Select	c.409_428dupGGCGGCTCGGCGGCGGCGGC	p.Ser145AlafsTer100	frameshift	Exon 1 of 21	ENSP00000419361.1
	ADCY5	ENST00000850916.1		c.571_590dupGGCGGCTCGGCGGCGGCGGC	p.Ser199AlafsTer100	frameshift	Exon 1 of 21	ENSP00000520999.1
	ADCY5	ENST00000699718.1		c.409_428dupGGCGGCTCGGCGGCGGCGGC	p.Ser145AlafsTer100	frameshift	Exon 1 of 22	ENSP00000514543.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 28

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Pathogenic:1

Aug 16, 2019

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3
Mutation Taster		=13/187	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553751262; hg19: chr3-123166964;