NM_207034.3:c.167_190dupAGACTGTGGCTGGCCCTGGCGAGG
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_207034.3(EDN3):c.167_190dupAGACTGTGGCTGGCCCTGGCGAGG(p.Glu56_Glu63dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000193 in 1,613,638 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_207034.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000678 AC: 103AN: 152024Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.000140 AC: 35AN: 249414Hom.: 0 AF XY: 0.000155 AC XY: 21AN XY: 135122
GnomAD4 exome AF: 0.000139 AC: 203AN: 1461498Hom.: 1 Cov.: 32 AF XY: 0.000151 AC XY: 110AN XY: 727078
GnomAD4 genome AF: 0.000716 AC: 109AN: 152140Hom.: 0 Cov.: 33 AF XY: 0.000659 AC XY: 49AN XY: 74386
ClinVar
Submissions by phenotype
not provided Uncertain:2
In-frame duplication of 8 amino acids in a propeptide molecular processing region; Has not been previously published as pathogenic or benign to our knowledge -
This variant, c.167_190dup, results in the insertion of 8 amino acid(s) of the EDN3 protein (p.Glu56_Glu63dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs755031787, gnomAD 0.2%). This variant has not been reported in the literature in individuals affected with EDN3-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
EDN3-related disorder Uncertain:1
The EDN3 c.167_190dup24 variant is predicted to result in an in-frame duplication (p.Glu56_Glu63dup). To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.16% of alleles in individuals of African descent in gnomAD. Although we suspect that this variant may be benign, at this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
Waardenburg syndrome type 4B;C3150975:Hirschsprung disease, susceptibility to, 4 Uncertain:1
- -
Megacolon;C5399764:Abnormal rectum morphology Uncertain:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at