X-108687498-T-TGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCA

Position:

• chrX-108687498-T-TGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCA

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_033380.3(COL4A5):​c.4344_4379dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG​(p.Gly1460_Thr1461insProAspGlyLeuGlnGlyProProGlyProProGly) variant causes a disruptive inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 23)
• Consequence: COL4A5 NM_033380.3 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 8.15

Genes affected

COL4A5 (HGNC:2207): (collagen type IV alpha 5 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. Mutations in this gene are associated with X-linked Alport syndrome, also known as hereditary nephritis. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]

COL4A5 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_033380.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
COL4A5	NM_033380.3	c.4344_4379dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG	p.Gly1460_Thr1461insProAspGlyLeuGlnGlyProProGlyProProGly	disruptive_inframe_insertion	49/53	ENST00000328300.11	NP_203699.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
COL4A5	ENST00000328300.11	c.4344_4379dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG	p.Gly1460_Thr1461insProAspGlyLeuGlnGlyProProGlyProProGly	disruptive_inframe_insertion	49/53	1	NM_033380.3	ENSP00000331902.7
COL4A5	ENST00000361603.7	c.4326_4361dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG	p.Gly1454_Thr1455insProAspGlyLeuGlnGlyProProGlyProProGly	disruptive_inframe_insertion	47/51	2		ENSP00000354505.2
COL4A5	ENST00000515658.1	c.138_173dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG	p.Gly58_Thr59insProAspGlyLeuGlnGlyProProGlyProProGly	disruptive_inframe_insertion	3/4	5		ENSP00000423520.1
COL4A5	ENST00000510690.2	n.838_873dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG		non_coding_transcript_exon_variant	7/11	4

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 23

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs281874736; hg19: chrX-107930728;