X-136874258-CCATAGAAGGGGGAAGCCCTCTTT-C

Variant names:

• chrX-136874258-CCATAGAAGGGGGAAGCCCTCTTT-C
• NM_002139.4:c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_Strong PM2 PP5

The NM_002139.4(RBMX):​c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG​(p.Glu346GlyfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 34)
• Consequence: RBMX NM_002139.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.84

Genes affected

RBMX (HGNC:9910): (RNA binding motif protein X-linked) This gene belongs to the RBMY gene family which includes candidate Y chromosome spermatogenesis genes. This gene, an active X chromosome homolog of the Y chromosome RBMY gene, is widely expressed whereas the RBMY gene evolved a male-specific function in spermatogenesis. Pseudogenes of this gene, found on chromosomes 1, 4, 9, 11, and 6, were likely derived by retrotransposition from the original gene. Alternatively spliced transcript variants encoding different isoforms have been identified. A snoRNA gene (SNORD61) is found in one of its introns. [provided by RefSeq, Sep 2009]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.118 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-136874258-CCATAGAAGGGGGAAGCCCTCTTT-C is Pathogenic according to our data. Variant chrX-136874258-CCATAGAAGGGGGAAGCCCTCTTT-C is described in ClinVar as [Pathogenic]. Clinvar id is 372147.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RBMX	NM_002139.4	c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG	p.Glu346GlyfsTer9	frameshift_variant	Exon 9 of 9	ENST00000320676.11	NP_002130.2
RBMX	NM_001164803.2	c.540+805_540+827delAAAGAGGGCTTCCCCCTTCTATG		intron_variant	Intron 6 of 7		NP_001158275.1
RBMX	NR_028476.2	n.1020_1042delAAAGAGGGCTTCCCCCTTCTATG		non_coding_transcript_exon_variant	Exon 8 of 8
RBMX	NR_028477.2	n.1227_1249delAAAGAGGGCTTCCCCCTTCTATG		non_coding_transcript_exon_variant	Exon 9 of 9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RBMX	ENST00000320676.11	c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG	p.Glu346GlyfsTer9	frameshift_variant	Exon 9 of 9	1	NM_002139.4	ENSP00000359645.3

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Syndromic X-linked intellectual disability Shashi type Pathogenic:1

Mar 13, 2024

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-135956417;