X-136874258-CCATAGAAGGGGGAAGCCCTCTTT-C

Variant names:

• chrX-136874258-CCATAGAAGGGGGAAGCCCTCTTT-C
• NM_002139.4:c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_002139.4(RBMX):​c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG​(p.Glu346GlyfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 34)
• Consequence: RBMX NM_002139.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.84
• Publications: 0 publications found

Genes affected

RBMX (HGNC:9910): (RNA binding motif protein X-linked) This gene belongs to the RBMY gene family which includes candidate Y chromosome spermatogenesis genes. This gene, an active X chromosome homolog of the Y chromosome RBMY gene, is widely expressed whereas the RBMY gene evolved a male-specific function in spermatogenesis. Pseudogenes of this gene, found on chromosomes 1, 4, 9, 11, and 6, were likely derived by retrotransposition from the original gene. Alternatively spliced transcript variants encoding different isoforms have been identified. A snoRNA gene (SNORD61) is found in one of its introns. [provided by RefSeq, Sep 2009]

RBMX Gene-Disease associations (from GenCC):

• syndromic X-linked intellectual disability Shashi type

  Inheritance: Unknown, XL Classification: MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant X-136874258-CCATAGAAGGGGGAAGCCCTCTTT-C is Pathogenic according to our data. Variant chrX-136874258-CCATAGAAGGGGGAAGCCCTCTTT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 372147.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002139.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RBMX	NM_002139.4	MANE Select	c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG	p.Glu346GlyfsTer9	frameshift	Exon 9 of 9	NP_002130.2	P38159-1
	RBMX	NM_001164803.2		c.540+805_540+827delAAAGAGGGCTTCCCCCTTCTATG		intron	N/A	NP_001158275.1	P38159-3
	RBMX	NR_028476.2		n.1020_1042delAAAGAGGGCTTCCCCCTTCTATG		non_coding_transcript_exon	Exon 8 of 8

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RBMX	ENST00000320676.11	TSL:1 MANE Select	c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG	p.Glu346GlyfsTer9	frameshift	Exon 9 of 9	ENSP00000359645.3	P38159-1
	RBMX	ENST00000562646.5	TSL:1	c.*779_*801delAAAGAGGGCTTCCCCCTTCTATG		3_prime_UTR	Exon 8 of 8	ENSP00000457051.1	H3BT71
	RBMX	ENST00000568578.5	TSL:1	n.*1261_*1283delAAAGAGGGCTTCCCCCTTCTATG		non_coding_transcript_exon	Exon 7 of 8	ENSP00000457691.1	H3BR27

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Syndromic X-linked intellectual disability Shashi type (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8
Mutation Taster		=9/191	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chrX-135956417;