X-154379529-GCTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGTACGC-G

Position:

• chrX-154379529-GCTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGTACGC-G

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_000117.3(EMD):​c.46_82+6delCTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGTACGC​(p.Leu16fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 25)
• Consequence: EMD NM_000117.3 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.05

Genes affected

EMD (HGNC:3331): (emerin) Emerin is a serine-rich nuclear membrane protein and a member of the nuclear lamina-associated protein family. It mediates membrane anchorage to the cytoskeleton. Dreifuss-Emery muscular dystrophy is an X-linked inherited degenerative myopathy resulting from mutation in the emerin gene. [provided by RefSeq, Jul 2008]

EMD (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.94 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-154379529-GCTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGTACGC-G is Pathogenic according to our data. Variant chrX-154379529-GCTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGTACGC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 433168.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
EMD	NM_000117.3	c.46_82+6delCTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGTACGC	p.Leu16fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	1/6	ENST00000369842.9	NP_000108.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
EMD	ENST00000369842.9	c.46_82+6delCTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGTACGC	p.Leu16fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	1/6	1	NM_000117.3	ENSP00000358857.4

Frequencies

GnomAD3 genomes Cov.: 25

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 25

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Molecular Diagnostics Lab, Nemours Children's Health, Delaware

Jul 14, 2016

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1557182198; hg19: chrX-153607889;