X-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C

Variant names:

• chrX-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C
• rs587776730
• NM_001360016.2:c.957_980delCAAAGGGTACCTGGACGACCCCAC

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1 PM4 PP3 PP5_Very_Strong

The NM_001360016.2(G6PD):​c.957_980delCAAAGGGTACCTGGACGACCCCAC​(p.Lys320_Thr327del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T319T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 24)
• Consequence: G6PD NM_001360016.2 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 9.23
• Publications: 1 publications found

Genes affected

G6PD (HGNC:4057): (glucose-6-phosphate dehydrogenase) This gene encodes glucose-6-phosphate dehydrogenase. This protein is a cytosolic enzyme encoded by a housekeeping X-linked gene whose main function is to produce NADPH, a key electron donor in the defense against oxidizing agents and in reductive biosynthetic reactions. G6PD is remarkable for its genetic diversity. Many variants of G6PD, mostly produced from missense mutations, have been described with wide ranging levels of enzyme activity and associated clinical symptoms. G6PD deficiency may cause neonatal jaundice, acute hemolysis, or severe chronic non-spherocytic hemolytic anemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

G6PD Gene-Disease associations (from GenCC):

• anemia, nonspherocytic hemolytic, due to G6PD deficiency

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• G6PD deficiency

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• class I glucose-6-phosphate dehydrogenase deficiency

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 13 ACMG points.

• PM1: In a hotspot region, there are 7 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 4 uncertain in NM_001360016.2
• PM4: Nonframeshift variant in NON repetitive region in NM_001360016.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C is Pathogenic according to our data. Variant chrX-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 10411.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001360016.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	G6PD	NM_001360016.2	MANE Select	c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	Exon 9 of 13	NP_001346945.1
	G6PD	NM_000402.4		c.1047_1070delCAAAGGGTACCTGGACGACCCCAC	p.Lys350_Thr357del	disruptive_inframe_deletion	Exon 9 of 13	NP_000393.4
	G6PD	NM_001042351.3		c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	Exon 9 of 13	NP_001035810.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	G6PD	ENST00000393562.10	TSL:1 MANE Select	c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	Exon 9 of 13	ENSP00000377192.3
	G6PD	ENST00000696421.1		c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	Exon 9 of 13	ENSP00000512616.1
	G6PD	ENST00000369620.6	TSL:5	c.1095_1118delCAAAGGGTACCTGGACGACCCCAC	p.Lys366_Thr373del	disruptive_inframe_deletion	Exon 9 of 13	ENSP00000358633.2

Frequencies

GnomAD3 genomes Cov.: 24

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 24

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:9

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Anemia, nonspherocytic hemolytic, due to G6PD deficiency Pathogenic:5

Dec 02, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.957_980del, results in the deletion of 8 amino acid(s) of the G6PD protein (p.Lys320_Thr327del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with G6PD deficiency (PMID: 8241497, 16753852; internal data). ClinVar contains an entry for this variant (Variation ID: 10411). This variant disrupts a region of the G6PD protein in which other variant(s) (p.Gly321Glu) have been determined to be pathogenic (PMID: 30988594; internal data). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic.

Dec 01, 1993

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

May 31, 2022

Revvity Omics, Revvity

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Aug 12, 2022

Dunham Lab, University of Washington

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

Variant found in unrelated hemizygotes with deficiency and CNSHA (PS4_M, PP4). No detectable activity in red blood cells (PS3). Leads to deletion of eight amino acids (PM4). Not found in gnomAD (PM2). Post_P 0.997 (odds of pathogenicity 3158, Prior_P 0.1).

Feb 21, 2022

Johns Hopkins Genomics, Johns Hopkins University

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This G6PD variant (rs587776730) is absent from a large population dataset and has been reported to ClinVar. This Class I variant, sometimes referred to as "G6PD Nara", has been identified in three unrelated males with chronic-hemolytic anemia. This 24-bp deletion in exon 9 of the G6PD gene removes eight amino acids, leaving the rest of the protein in-frame. No measurable G6PD activity was detected in the hemolysate of a patient with this variant, and the partially purified protein was reported to be extremely thermolabile with rapid loss of activity. This variant was also identified in the patient's asymptomatic mother (JHG1850-2). Based on the available evidence, we consider this variant to be likely pathogenic.

not provided Pathogenic:3

Dec 29, 2020

Mayo Clinic Laboratories, Mayo Clinic

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PM2, PM4, PP4, PS4_supporting

Sep 19, 2019

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The G6PD c.957_980del; p.Lys320_Thr327del variant (rs587776730), also known as G6PD Nara, is reported in the literature in an individual affected with G6PD deficiency (Hirono 1993). This variant deletes eight amino acids, leaving the rest of the protein in-frame. Functional analysis of hemolysate from an affected individual with this variant showed no detectable G6PD activity, and the variant protein was reported to be extremely thermolabile with rapid loss of residual enzyme activity (Hirono 1993). This variant is absent from general population databases (Exome Variant Server, Genome Aggregation Database), indicating it is not a common polymorphism. Based on available information, this variant is considered to be likely pathogenic. References: Hirono A et al. G6PD Nara: a new class 1 glucose-6-phosphate dehydrogenase variant with an eight amino acid deletion. Blood. 1993 Dec 1;82(11):3250-2.

Feb 26, 2025

GeneDx

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame deletion of 8 of amino acidsin a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 9674740, 8241497, 16753852)

Malaria, susceptibility to;C2720289:Anemia, nonspherocytic hemolytic, due to G6PD deficiency Pathogenic:1

Juno Genomics, Hangzhou Juno Genomics, Inc

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Absent from controls (or at extremely low frequency if recessive) in Genome Aggregation Database, Exome Sequencing Project, 1000 Genomes Project, or Exome Aggregation Consortium.;Protein length changes due to in-frame deletions/insertions in a non-repeat region or stop-loss variants.;The prevalence of the variant in affected individuals is significantly increased compared to the prevalence in controls.;Patient's phenotype or family history is highly specific for a disease with a single genetic etiology.;Well-established in vitro or in vivo functional studies supportive of a damaging effect on the gene or gene product.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587776730; hg19: chrX-153761227;