chrX-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C

Position:

• chrX-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_001360016.2(G6PD):​c.957_980delCAAAGGGTACCTGGACGACCCCAC​(p.Lys320_Thr327del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency: Genomes: not found (cov: 24)
• Consequence: G6PD NM_001360016.2 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:7 U:1
• Conservation: PhyloP100: 9.23

Genes affected

G6PD (HGNC:4057): (glucose-6-phosphate dehydrogenase) This gene encodes glucose-6-phosphate dehydrogenase. This protein is a cytosolic enzyme encoded by a housekeeping X-linked gene whose main function is to produce NADPH, a key electron donor in the defense against oxidizing agents and in reductive biosynthetic reactions. G6PD is remarkable for its genetic diversity. Many variants of G6PD, mostly produced from missense mutations, have been described with wide ranging levels of enzyme activity and associated clinical symptoms. G6PD deficiency may cause neonatal jaundice, acute hemolysis, or severe chronic non-spherocytic hemolytic anemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

G6PD (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001360016.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C is Pathogenic according to our data. Variant chrX-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 10411.We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=1, Pathogenic=2, Likely_pathogenic=4}. Variant chrX-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
G6PD	NM_001360016.2	c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	9/13	ENST00000393562.10	NP_001346945.1
G6PD	NM_000402.4	c.1047_1070delCAAAGGGTACCTGGACGACCCCAC	p.Lys350_Thr357del	disruptive_inframe_deletion	9/13		NP_000393.4
G6PD	NM_001042351.3	c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	9/13		NP_001035810.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
G6PD	ENST00000393562.10	c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	9/13	1	NM_001360016.2	ENSP00000377192.3

Frequencies

GnomAD3 genomes Cov.: 24

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 24

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:7 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Anemia, nonspherocytic hemolytic, due to G6PD deficiency Pathogenic:4 Uncertain:1

Likely pathogenic, criteria provided, single submitter	clinical testing	Johns Hopkins Genomics, Johns Hopkins University	Feb 21, 2022	This G6PD variant (rs587776730) is absent from a large population dataset and has been reported to ClinVar. This Class I variant, sometimes referred to as "G6PD Nara", has been identified in three unrelated males with chronic-hemolytic anemia. This 24-bp deletion in exon 9 of the G6PD gene removes eight amino acids, leaving the rest of the protein in-frame. No measurable G6PD activity was detected in the hemolysate of a patient with this variant, and the partially purified protein was reported to be extremely thermolabile with rapid loss of activity. This variant was also identified in the patient's asymptomatic mother (JHG1850-2). Based on the available evidence, we consider this variant to be likely pathogenic. -
Pathogenic, criteria provided, single submitter	curation	Dunham Lab, University of Washington	Aug 12, 2022	Variant found in unrelated hemizygotes with deficiency and CNSHA (PS4_M, PP4). No detectable activity in red blood cells (PS3). Leads to deletion of eight amino acids (PM4). Not found in gnomAD (PM2). Post_P 0.997 (odds of pathogenicity 3158, Prior_P 0.1). -
Pathogenic, no assertion criteria provided	literature only	OMIM	Dec 01, 1993	- -
Uncertain significance, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	May 01, 2023	This variant has been observed in individual(s) with G6PD deficiency (PMID: 8241497, 16753852; Invitae). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant disrupts a region of the G6PD protein in which other variant(s) (p.Tyr322His) have been observed in individuals with G6PD-related conditions (PMID: 11112389). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. ClinVar contains an entry for this variant (Variation ID: 10411). This variant is not present in population databases (gnomAD no frequency). This variant, c.957_980del, results in the deletion of 8 amino acid(s) of the G6PD protein (p.Lys320_Thr327del), but otherwise preserves the integrity of the reading frame. -
Likely pathogenic, criteria provided, single submitter	clinical testing	Revvity Omics, Revvity	May 31, 2022	- -

not provided Pathogenic:2

Likely pathogenic, criteria provided, single submitter	clinical testing	Mayo Clinic Laboratories, Mayo Clinic	Dec 29, 2020	PM2, PM4, PP4, PS4_supporting -
Likely pathogenic, criteria provided, single submitter	clinical testing	ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories	Sep 19, 2019	The G6PD c.957_980del; p.Lys320_Thr327del variant (rs587776730), also known as G6PD Nara, is reported in the literature in an individual affected with G6PD deficiency (Hirono 1993). This variant deletes eight amino acids, leaving the rest of the protein in-frame. Functional analysis of hemolysate from an affected individual with this variant showed no detectable G6PD activity, and the variant protein was reported to be extremely thermolabile with rapid loss of residual enzyme activity (Hirono 1993). This variant is absent from general population databases (Exome Variant Server, Genome Aggregation Database), indicating it is not a common polymorphism. Based on available information, this variant is considered to be likely pathogenic. References: Hirono A et al. G6PD Nara: a new class 1 glucose-6-phosphate dehydrogenase variant with an eight amino acid deletion. Blood. 1993 Dec 1;82(11):3250-2. -

Malaria, susceptibility to;C2720289:Anemia, nonspherocytic hemolytic, due to G6PD deficiency Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Juno Genomics, Hangzhou Juno Genomics, Inc

-

PM2_Supporting+PM4+PS4_Supporting+PP4_Moderate+PS3 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587776730; hg19: chrX-153761227;