rs587776730

Variant names:

• chrX-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C
• rs587776730
• NM_001360016.2:c.957_980delCAAAGGGTACCTGGACGACCCCAC

Variant summary

Our verdict is Pathogenic. The variant received 17 ACMG points: 17P and 0B. PS3 PM1 PM4 PP3 PP5_Very_Strong

The NM_001360016.2(G6PD):​c.957_980delCAAAGGGTACCTGGACGACCCCAC​(p.Lys320_Thr327del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV002570289: No measurable G6PD activity was detected in the hemolysate of a patient with this variant, and the partially purified protein was reported to be extremely thermolabile with rapid loss of activity." and additional evidence is available in ClinVar. Synonymous variant affecting the same amino acid position (i.e. T319T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 24)
• Consequence: G6PD NM_001360016.2 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 9.23
• Publications: 1 publications found

Genes affected

G6PD (HGNC:4057): (glucose-6-phosphate dehydrogenase) This gene encodes glucose-6-phosphate dehydrogenase. This protein is a cytosolic enzyme encoded by a housekeeping X-linked gene whose main function is to produce NADPH, a key electron donor in the defense against oxidizing agents and in reductive biosynthetic reactions. G6PD is remarkable for its genetic diversity. Many variants of G6PD, mostly produced from missense mutations, have been described with wide ranging levels of enzyme activity and associated clinical symptoms. G6PD deficiency may cause neonatal jaundice, acute hemolysis, or severe chronic non-spherocytic hemolytic anemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

G6PD Gene-Disease associations (from GenCC):

• anemia, nonspherocytic hemolytic, due to G6PD deficiency

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• G6PD deficiency

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• class I glucose-6-phosphate dehydrogenase deficiency

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 17 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV002570289: No measurable G6PD activity was detected in the hemolysate of a patient with this variant, and the partially purified protein was reported to be extremely thermolabile with rapid loss of activity.; SCV002599351: No; SCV001473440: Functional analysis of hemolysate from an affected individual with this variant showed no detectable G6PD activity, and the variant protein was reported to be extremely thermolabile with rapid loss of residual enzyme activity (Hirono A et al. G6PD Nara: a new class 1 glucose-6-phosphate dehydrogenase variant with an eight amino acid deletion. Blood. 1993 Dec 1;82(11):3250-2.); SCV005416057: "Well-established in vitro or in vivo functional studies supportive of a damaging effect on the gene or gene product."
• PM1: In a hotspot region, there are 7 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 4 uncertain in NM_001360016.2
• PM4: Nonframeshift variant in NON repetitive region in NM_001360016.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C is Pathogenic according to our data. Variant chrX-154533012-CGTGGGGTCGTCCAGGTACCCTTTG-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 10411.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001360016.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	G6PD	NM_001360016.2	MANE Select	c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	Exon 9 of 13	NP_001346945.1	A0A384NL00
	G6PD	NM_000402.4		c.1047_1070delCAAAGGGTACCTGGACGACCCCAC	p.Lys350_Thr357del	disruptive_inframe_deletion	Exon 9 of 13	NP_000393.4	P11413-3
	G6PD	NM_001042351.3		c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	Exon 9 of 13	NP_001035810.1	P11413-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	G6PD	ENST00000393562.10	TSL:1 MANE Select	c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	Exon 9 of 13	ENSP00000377192.3	P11413-1
	G6PD	ENST00000696421.1		c.957_980delCAAAGGGTACCTGGACGACCCCAC	p.Lys320_Thr327del	disruptive_inframe_deletion	Exon 9 of 13	ENSP00000512616.1	A0A8Q3SIS5
	G6PD	ENST00000369620.6	TSL:5	c.1095_1118delCAAAGGGTACCTGGACGACCCCAC	p.Lys366_Thr373del	disruptive_inframe_deletion	Exon 9 of 13	ENSP00000358633.2	P11413-2

Frequencies

GnomAD3 genomes Cov.: 24

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 24

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
5	-	-	Anemia, nonspherocytic hemolytic, due to G6PD deficiency (5)
3	-	-	not provided (3)
1	-	-	Malaria, susceptibility to;C2720289:Anemia, nonspherocytic hemolytic, due to G6PD deficiency (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587776730; hg19: chrX-153761227;