X-18603931-AGTCTCACCACAGATCTAACAGC-A

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_001323289.2(CDKL5):​c.1008_1029delGTCTCACCACAGATCTAACAGC​(p.Ser337fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 22)

Consequence

CDKL5
NM_001323289.2 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 7.57
Variant links:
Genes affected
CDKL5 (HGNC:11411): (cyclin dependent kinase like 5) This gene is a member of Ser/Thr protein kinase family and encodes a phosphorylated protein with protein kinase activity. Mutations in this gene have been associated with X-linked infantile spasm syndrome (ISSX), also known as X-linked West syndrome, and Rett syndrome (RTT). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-18603931-AGTCTCACCACAGATCTAACAGC-A is Pathogenic according to our data. Variant chrX-18603931-AGTCTCACCACAGATCTAACAGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 189551.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
CDKL5NM_001323289.2 linkuse as main transcriptc.1008_1029delGTCTCACCACAGATCTAACAGC p.Ser337fs frameshift_variant 12/18 ENST00000623535.2 NP_001310218.1 O76039-2
CDKL5NM_001037343.2 linkuse as main transcriptc.1008_1029delGTCTCACCACAGATCTAACAGC p.Ser337fs frameshift_variant 13/22 NP_001032420.1 O76039-1
CDKL5NM_003159.3 linkuse as main transcriptc.1008_1029delGTCTCACCACAGATCTAACAGC p.Ser337fs frameshift_variant 12/21 NP_003150.1 O76039-1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
CDKL5ENST00000623535.2 linkuse as main transcriptc.1008_1029delGTCTCACCACAGATCTAACAGC p.Ser337fs frameshift_variant 12/181 NM_001323289.2 ENSP00000485244.1 O76039-2

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Developmental and epileptic encephalopathy, 2 Pathogenic:1
Pathogenic, no assertion criteria providedcurationRettBASEMar 13, 2014- -
CDKL5 disorder Pathogenic:1
Pathogenic, criteria provided, single submittercurationCentre for Population Genomics, CPGSep 18, 2024This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant has been identified as a de novo occurrence in an individual with CDKL5 disorder without confirmation of paternity and maternity (PM6). PMID: 23064044 This variant is absent from gnomAD v4 (PM2_Supporting). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs786204964; hg19: chrX-18622051; API