X-25013543-GCGGCCGCGGCTGCCGCGGCGGCCC-G
Variant summary
Our verdict is Benign. The variant received -10 ACMG points: 2P and 12B. PM4BP6_Very_StrongBS2
The NM_139058.3(ARX):c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG(p.Gly143_Ala150del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000176 in 794,928 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 4 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_139058.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- genetic developmental and epileptic encephalopathyInheritance: AD, XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- intellectual disability, X-linked, with or without seizures, ARX-relatedInheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: G2P, Ambry Genetics
- Partington syndromeInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- X-linked complex neurodevelopmental disorderInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- X-linked lissencephaly with abnormal genitaliaInheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, Ambry Genetics
- infantile spasmsInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- corpus callosum agenesis-abnormal genitalia syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- infantile epileptic-dyskinetic encephalopathyInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked spasticity-intellectual disability-epilepsy syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes AF: 0.00000959 AC: 1AN: 104289Hom.: 0 Cov.: 21 show subpopulations
GnomAD4 exome AF: 0.0000188 AC: 13AN: 690639Hom.: 0 AF XY: 0.0000191 AC XY: 4AN XY: 209747 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000959 AC: 1AN: 104289Hom.: 0 Cov.: 21 AF XY: 0.00 AC XY: 0AN XY: 29767 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.