NM_139058.3:c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG

Variant names:

• chrX-25013543-GCGGCCGCGGCTGCCGCGGCGGCCC-G
• rs387906493
• NM_139058.3:c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG

GermlineCancer (beta)

Variant summary

Our verdict is Likely benign.

-6 Likely Benign

-7

-6

-1

0

+5

+6

+9

+10

BenignB

Likely BenignLB

UncertainVUS

Likely PathogenicLP

PathogenicP

The variant received -6 classification points (ACMG Germline Pathogenicity v2019). PM4BS2BP6_Strong

The NM_139058.3(ARX):c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG (p.Gly143_Ala150del) variant causes a disruptive inframe deletion change. The variant results in an in-frame change. Note: allele frequency estimates from gnomAD may be inaccurate for this variant type (MNP or indel longer than 3 bp) due to technology limitations. The variant allele was found at a cumulative frequency of 0.0000176 (AC=14) in the gnomAD database across 794,928 control chromosomes, including 4 hemizygotes. The grpmax filtering allele frequency (95% CI) is 0.00002. Variant has been reported in ClinVar as Benign/Likely Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0000096 (0 hom., 0 hem., cov: 21)
  • Exomes 𝑓: 0.000019 (0 hom. 4 hem.)
• Consequence: ARX NM_139058.3 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 2.09
• Publications: 20 publications found

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ARX Gene-Disease associations (from GenCC):

• genetic developmental and epileptic encephalopathy

  Inheritance: XL, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P, ClinGen
• developmental and epileptic encephalopathy, 1

  Inheritance: XL Classification: STRONG Submitted by: PanelApp Australia
• neurodevelopmental disorder

  Inheritance: XL Classification: STRONG Submitted by: PanelApp Australia
• X-linked lissencephaly with abnormal genitalia

  Inheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
• intellectual disability, X-linked, with or without seizures, ARX-related

  Inheritance: XL Classification: MODERATE Submitted by: Ambry Genetics
• corpus callosum agenesis-abnormal genitalia syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• infantile epileptic-dyskinetic encephalopathy

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• Partington syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked spasticity-intellectual disability-epilepsy syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

Classification according to ACMG Germline Pathogenicity v2019

Classification was made for transcript:

Our verdict: Likely_benign. The variant received -6 points.

Apply	Criterion Code & Title / Strength	Strength	Rationale / Clinical Context
	PM4Protein length change in non-repeat region		In-frame indel in non-repetitive region — protein length change (PM4); In-frame indel in non-repetitive region — protein length change (8 AA).
	BP6Reputable source reports benign		ClinVar 2-star benign — strong (BP6); ClinVar germline classification: Benign/Likely Benign, 2 star(s).
	BS2Observed in healthy adult		≥2 hemizygous males in gnomAD — observed in healthy males (BS2); GnomAD homozygous count = 0.; GnomAD hemizygous male AC = 4.; Cumulative gnomAD AC = 14 (pure AD gene, not AR).; Cumulative gnomAD AC = 14 does not exceed known P/LP transcript maximum AC = 16 — BS2 blocked.

Variant Effect in Transcripts

Automated classification analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated classification assignments.

RefSeq Transcripts

Sel.	Gene / Transcript	Tags	HGVSc / HGVSp	Effect	Exon rank	Protein / UniProt
	ARX NM_139058.3	MANE Select	c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG p.Gly143_Ala150del	disruptive_inframe_deletion	Exon 2 of 5	Prot: NP_620689.1 UniProt:

ARX NM_139058.3

MANE Select

HGVSc / HGVSpc.428_451delGGGCCGCCGCGGCAGCCGCGGCCGp.Gly143_Ala150del

Exon rankExon 2 of 5

disruptive_inframe_deletion

Prot: NP_620689.1UniProt: Q96QS3

Ensembl Transcripts

Sel.	Gene / Transcript	Tags	HGVSc / HGVSp	Effect	Exon rank	Protein / UniProt
	ARX ENST00000379044.5	TSL:1MANE Select	c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG p.Gly143_Ala150del	disruptive_inframe_deletion	Exon 2 of 5	Prot: ENSP00000368332.4 UniProt:

ARX ENST00000379044.5

TSL:1MANE Select

HGVSc / HGVSpc.428_451delGGGCCGCCGCGGCAGCCGCGGCCGp.Gly143_Ala150del

Exon rankExon 2 of 5

disruptive_inframe_deletion

Prot: ENSP00000368332.4UniProt: Q96QS3

Frequencies

Allele frequencies (AF), counts (AC/AN), homozygotes and coverage

Common (AF > 0.05 / Hom > 5)

Rare (AF ≤ 0.0001 / Hom ≤ 1)

Source / population	AF	AC	Hom	AN	Coverage
Global population databases 5 sources Large-scale international reference populations
GnomAD3 genomes	AF: 0.00000959	AC:1	Hom:0	AN:104289	Cov:21
GnomAD4 exome	AF: 0.0000188	AC:13	Hom:0	AN:690639	Cov:
GnomAD4 genome	AF: 0.00000959	AC:1	Hom:0	AN:104289	Cov:21
TOPMed (Bravo)	AF: 0.0000189	AC:5	Hom:2	AN:264690	Cov:
ALFA (dbGaP/dbSNP Allele Frequency Aggregator)	AF: 0.000102	AC:2	Hom:1	AN:19648	Cov:

Showing 5 sources

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 (1)
-	-	1	not provided (1)

Computational Scores

Algorithm	Calibrated pred.	Score	Prediction
PhyloP100	Benign	2.1

Showing 1 of 1 scores

Splicing Scores

No splicing scores have been computed for this variant.

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

MaveDB functional evidence

MaveDB is a public repository of laboratory assays that test the effect of thousands of variants at once — treat this as supporting research data and interpret it with great caution; it is not a clinical classification.

No MaveDB functional evidence found for this variant.

Other links and lift over

dbSNP: rs387906493;

hg19: chrX-25031660;

ACMG debug oncogenicity

ACGS debug oncogenicity

ACMG debug germline

Submit to ClinVar