X-31223122-CTGAAAAGAGGGAAAACAAAGAGCATT-C
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_ModeratePP5_Moderate
The NM_004006.3(DMD):c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA variant causes a splice acceptor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_004006.3 splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
- dilated cardiomyopathy 3BInheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
- Duchenne and Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- Duchenne muscular dystrophyInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Orphanet
- progressive muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- symptomatic form of muscular dystrophy of Duchenne and Becker in female carriersInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004006.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | NM_004006.3 | MANE Select | c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | NP_003997.2 | |||
| DMD | NM_004009.3 | c.9275-27_9275-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | NP_004000.1 | ||||
| DMD | NM_000109.4 | c.9263-27_9263-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | NP_000100.3 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | ENST00000357033.9 | TSL:1 MANE Select | c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | ENSP00000354923.3 | |||
| DMD | ENST00000378723.7 | TSL:1 | c.83-27_83-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | ENSP00000367997.3 | |||
| DMD | ENST00000361471.8 | TSL:1 | c.83-27_83-2delAATGCTCTTTGTTTTCCCTCTTTTCA | splice_acceptor splice_region intron | N/A | ENSP00000354464.4 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Submissions by phenotype
Duchenne muscular dystrophy Pathogenic:1
In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Nucleotide substitutions within the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has been observed in individual(s) with clinical features of Duchenne muscular dystrophy (Invitae). ClinVar contains an entry for this variant (Variation ID: 409934). This variant is not present in population databases (ExAC no frequency). This sequence change falls in intron 63 of the DMD gene. It does not directly change the encoded amino acid sequence of the DMD protein, but it affects a nucleotide within the consensus splice site of the intron.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at