rs1064792968

Variant names:

• chrX-31223122-CTGAAAAGAGGGAAAACAAAGAGCATT-C
• rs1064792968
• NM_004006.3:c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Moderate PP5_Moderate

The NM_004006.3(DMD):​c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA variant causes a splice acceptor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 23)
• Consequence: DMD NM_004006.3 splice_acceptor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.01
• Publications: 0 publications found

Genes affected

DMD (HGNC:2928): (dystrophin) This gene spans a genomic range of greater than 2 Mb and encodes a large protein containing an N-terminal actin-binding domain and multiple spectrin repeats. The encoded protein forms a component of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extracellular matrix. Deletions, duplications, and point mutations at this gene locus may cause Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or cardiomyopathy. Alternative promoter usage and alternative splicing result in numerous distinct transcript variants and protein isoforms for this gene. [provided by RefSeq, Dec 2016]

DMD Gene-Disease associations (from GenCC):

• Becker muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
• dilated cardiomyopathy 3B

  Inheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
• Duchenne and Becker muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• Duchenne muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Orphanet
• progressive muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• symptomatic form of muscular dystrophy of Duchenne and Becker in female carriers

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.00678242 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PP5: Variant X-31223122-CTGAAAAGAGGGAAAACAAAGAGCATT-C is Pathogenic according to our data. Variant chrX-31223122-CTGAAAAGAGGGAAAACAAAGAGCATT-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 409934.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DMD	NM_004006.3	c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA		splice_acceptor_variant, splice_region_variant, intron_variant	Intron 63 of 78	ENST00000357033.9	NP_003997.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DMD	ENST00000357033.9	c.9287-27_9287-2delAATGCTCTTTGTTTTCCCTCTTTTCA		splice_acceptor_variant, splice_region_variant, intron_variant	Intron 63 of 78	1	NM_004006.3	ENSP00000354923.3

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Duchenne muscular dystrophy Pathogenic:1

Jan 07, 2020

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Nucleotide substitutions within the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has been observed in individual(s) with clinical features of Duchenne muscular dystrophy (Invitae). ClinVar contains an entry for this variant (Variation ID: 409934). This variant is not present in population databases (ExAC no frequency). This sequence change falls in intron 63 of the DMD gene. It does not directly change the encoded amino acid sequence of the DMD protein, but it affects a nucleotide within the consensus splice site of the intron. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792968; hg19: chrX-31241239;