X-48791103-AGGCTCCATGGAGTTCCCTGGCCTGG-A

Position:

• chrX-48791103-AGGCTCCATGGAGTTCCCTGGCCTGG-A

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_002049.4(GATA1):​c.-4_21delCTCCATGGAGTTCCCTGGCCTGGGG​(p.Met1fs) variant causes a frameshift, start lost change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: GATA1 NM_002049.4 frameshift, start_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.28

Genes affected

GATA1 (HGNC:4170): (GATA binding protein 1) This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.999 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-48791103-AGGCTCCATGGAGTTCCCTGGCCTGG-A is Pathogenic according to our data. Variant chrX-48791103-AGGCTCCATGGAGTTCCCTGGCCTGG-A is described in ClinVar as [Pathogenic]. Clinvar id is 2952845.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
GATA1	NM_002049.4	c.-4_21delCTCCATGGAGTTCCCTGGCCTGGGG	p.Met1fs	frameshift_variant, start_lost	2/6	ENST00000376670.9	NP_002040.1
GATA1	NM_002049.4	c.-4_21delCTCCATGGAGTTCCCTGGCCTGGGG		5_prime_UTR_variant	2/6	ENST00000376670.9	NP_002040.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
GATA1	ENST00000376670.9	c.-4_21delCTCCATGGAGTTCCCTGGCCTGGGG	p.Met1fs	frameshift_variant, start_lost	2/6	1	NM_002049.4	ENSP00000365858.3
GATA1	ENST00000376670	c.-4_21delCTCCATGGAGTTCCCTGGCCTGGGG		5_prime_UTR_variant	2/6	1	NM_002049.4	ENSP00000365858.3

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Diamond-Blackfan anemia;C1845837:GATA binding protein 1 related thrombocytopenia with dyserythropoiesis Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Oct 14, 2023

This sequence change affects the initiator methionine of the GATA1 mRNA. The next in-frame methionine is located at codon 1. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with GATA1-related conditions. This variant disrupts a region of the GATA1 protein in which other variant(s) (p.Met1?) have been determined to be pathogenic (PMID: 24453067, 24952648, 29146883, 35328001; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-48649510;