X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP3BS2_Supporting
The NM_000044.6(AR):c.192_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln65_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000448 in 1,003,954 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 11 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_000044.6 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- androgen insensitivity syndromeInheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- Kennedy diseaseInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- partial androgen insensitivity syndromeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- complete androgen insensitivity syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| AR | NM_000044.6 | c.192_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln65_Gln80del | disruptive_inframe_deletion | Exon 1 of 8 | ENST00000374690.9 | NP_000035.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000195 AC: 13AN: 66636Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000341 AC: 32AN: 937331Hom.: 0 AF XY: 0.0000305 AC XY: 9AN XY: 295421 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000195 AC: 13AN: 66623Hom.: 0 Cov.: 0 AF XY: 0.000242 AC XY: 2AN XY: 8259 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at