chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T

Position:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T

Variant summary

Our verdict is Likely benign. Variant got -1 ACMG points: 0P and 1B. BS2_Supporting

The NM_000044.6(AR):​c.192_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln65_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000448 in 1,003,954 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 11 hemizygotes in GnomAD. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00020 (0 hom., 2 hem., cov: 0)
  • Exomes 𝑓: 0.000034 (0 hom. 9 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.40

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -1 ACMG points.

• BS2: High Hemizygotes in GnomAd4 at 2 XL geneVariant has number of hemizygotes lower than other variant known as pathogenic in the gene, so the strength is limited to Supporting.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AR	NM_000044.6	c.192_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln65_Gln80del	disruptive_inframe_deletion	1/8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.192_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln65_Gln80del	disruptive_inframe_deletion	1/8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.000195 AC: 13 AN: 66636 Hom.: 0 Cov.: 0 AF XY: 0.000243 AC XY: 2 AN XY: 8246

Gnomad AFR AF: 0.000106

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000317

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000341 AC: 32 AN: 937331 Hom.: 0 AF XY: 0.0000305 AC XY: 9 AN XY: 295421

Gnomad4 AFR exome AF: 0.0000421

Gnomad4 AMR exome AF: 0.0000773

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000352

Gnomad4 SAS exome AF: 0.0000221

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000264

Gnomad4 OTH exome AF: 0.000150

GnomAD4 genome AF: 0.000195 AC: 13 AN: 66623 Hom.: 0 Cov.: 0 AF XY: 0.000242 AC XY: 2 AN XY: 8259

Gnomad4 AFR AF: 0.000106

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000317

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;