X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Position:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BA1

The NM_000044.6(AR):​c.237_239dup​(p.Gln79dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0394 in 989,447 control chromosomes in the GnomAD database, including 2,419 homozygotes. There are 8,985 hemizygotes in GnomAD. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.081 (446 hom., 389 hem., cov: 0)
  • Exomes 𝑓: 0.036 (1973 hom. 8596 hem.)
• Consequence: AR NM_000044.6 inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:10
• Conservation: PhyloP100: 0.337

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant X-67545316-T-TGCA is Benign according to our data. Variant chrX-67545316-T-TGCA is described in ClinVar as [Likely_benign]. Clinvar id is 434257.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (AMR) allele frequency at 95% confidence interval = 0.106 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
AR	NM_000044.6	c.237_239dup	p.Gln79dup	inframe_insertion	1/8	ENST00000374690.9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
AR	ENST00000374690.9	c.237_239dup	p.Gln79dup	inframe_insertion	1/8	1	NM_000044.6	P1

Frequencies

GnomAD3 genomes AF: 0.0809 AC: 5386 AN: 66566 Hom.: 446 Cov.: 0 AF XY: 0.0472 AC XY: 389 AN XY: 8240

Gnomad AFR AF: 0.0554

Gnomad AMI AF: 0.0968

Gnomad AMR AF: 0.113

Gnomad ASJ AF: 0.0945

Gnomad EAS AF: 0.102

Gnomad SAS AF: 0.0892

Gnomad FIN AF: 0.0822

Gnomad MID AF: 0.124

Gnomad NFE AF: 0.0875

Gnomad OTH AF: 0.0773

GnomAD4 exome AF: 0.0364 AC: 33556 AN: 922896 Hom.: 1973 Cov.: 40 AF XY: 0.0304 AC XY: 8596 AN XY: 282430

Gnomad4 AFR exome AF: 0.0257

Gnomad4 AMR exome AF: 0.0745

Gnomad4 ASJ exome AF: 0.0539

Gnomad4 EAS exome AF: 0.109

Gnomad4 SAS exome AF: 0.0664

Gnomad4 FIN exome AF: 0.0949

Gnomad4 NFE exome AF: 0.0266

Gnomad4 OTH exome AF: 0.0500

GnomAD4 genome AF: 0.0809 AC: 5384 AN: 66551 Hom.: 446 Cov.: 0 AF XY: 0.0471 AC XY: 389 AN XY: 8253

Gnomad4 AFR AF: 0.0553

Gnomad4 AMR AF: 0.113

Gnomad4 ASJ AF: 0.0945

Gnomad4 EAS AF: 0.103

Gnomad4 SAS AF: 0.0903

Gnomad4 FIN AF: 0.0822

Gnomad4 NFE AF: 0.0875

Gnomad4 OTH AF: 0.0764

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:10

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:5

Benign, no assertion criteria provided	clinical testing	Genome Diagnostics Laboratory, University Medical Center Utrecht	-	- -
Likely benign, criteria provided, single submitter	clinical testing	Genetic Services Laboratory, University of Chicago	Aug 19, 2016	- -
Benign, no assertion criteria provided	clinical testing	Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center	-	- -
Likely benign, criteria provided, single submitter	clinical testing	Genomic Research Center, Shahid Beheshti University of Medical Sciences	May 03, 2020	- -
Benign, criteria provided, single submitter	clinical testing	Mendelics	May 04, 2022	- -

not provided Benign:4

Likely benign, no assertion criteria provided	clinical testing	Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen	-	- -
Likely benign, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Oct 01, 2016	- -
Benign, criteria provided, single submitter	clinical testing	GeneDx	Jul 13, 2015	- -
Likely benign, no assertion criteria provided	clinical testing	Department of Pathology and Laboratory Medicine, Sinai Health System	-	The AR p.Gln80dup variant was not identified in the literature but was identified in dbSNP (ID: rs3032358). The variant was identified in ClinVar (reported by Invitae as benign for Androgen resistance syndrome and Bulbo-spinal atrophy X-linked, and reported likely benign by Genetics Services Laboratory University of Chicago), Clinvitae, Cosmic (identified in neck tissue from squamous cell carcinoma cells) and LOVD 3.0 (predicted to be benign). The variant was not identified in the following control databases: the 1000 Genomes Project, the NHLBI GO Exome Sequencing Project, the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (Feb 27, 2017). This variant is an in-frame insertion resulting in the duplication of a glutamine (gln) residue at codon 80; the impact of this alteration on AR protein function is not known, however this insertion occurs in a variable poly-Q repeat region and was predicted to be a polymorphism by MutationTaster. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time although we would lean towards a more benign role for this variant. This variant is classified as likely benign. -

Androgen resistance syndrome;C1839259:Kennedy disease Benign:1

Benign, criteria provided, single submitter

clinical testing

Invitae

Jan 29, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;