X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Position:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BA1

The NM_000044.6(AR):​c.234_239dup​(p.Gln79_Gln80dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0348 in 985,708 control chromosomes in the GnomAD database, including 2,458 homozygotes. There are 5,284 hemizygotes in GnomAD. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.075 (390 hom., 382 hem., cov: 0)
  • Exomes 𝑓: 0.032 (2068 hom. 4902 hem.)
• Consequence: AR NM_000044.6 inframe_insertion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:8
• Conservation: PhyloP100: 0.337

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant X-67545316-T-TGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCA is described in ClinVar as [Benign]. Clinvar id is 290422.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (AMR) allele frequency at 95% confidence interval = 0.0889 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
AR	NM_000044.6	c.234_239dup	p.Gln79_Gln80dup	inframe_insertion	1/8	ENST00000374690.9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
AR	ENST00000374690.9	c.234_239dup	p.Gln79_Gln80dup	inframe_insertion	1/8	1	NM_000044.6	P1

Frequencies

GnomAD3 genomes AF: 0.0751 AC: 4999 AN: 66586 Hom.: 391 Cov.: 0 AF XY: 0.0463 AC XY: 381 AN XY: 8236

Gnomad AFR AF: 0.0371

Gnomad AMI AF: 0.0493

Gnomad AMR AF: 0.0931

Gnomad ASJ AF: 0.103

Gnomad EAS AF: 0.0941

Gnomad SAS AF: 0.0844

Gnomad FIN AF: 0.0549

Gnomad MID AF: 0.0980

Gnomad NFE AF: 0.0916

Gnomad OTH AF: 0.0810

GnomAD4 exome AF: 0.0319 AC: 29275 AN: 919135 Hom.: 2068 Cov.: 40 AF XY: 0.0176 AC XY: 4902 AN XY: 278389

Gnomad4 AFR exome AF: 0.0155

Gnomad4 AMR exome AF: 0.0649

Gnomad4 ASJ exome AF: 0.0570

Gnomad4 EAS exome AF: 0.0822

Gnomad4 SAS exome AF: 0.0487

Gnomad4 FIN exome AF: 0.0592

Gnomad4 NFE exome AF: 0.0255

Gnomad4 OTH exome AF: 0.0468

GnomAD4 genome AF: 0.0750 AC: 4996 AN: 66573 Hom.: 390 Cov.: 0 AF XY: 0.0463 AC XY: 382 AN XY: 8249

Gnomad4 AFR AF: 0.0370

Gnomad4 AMR AF: 0.0929

Gnomad4 ASJ AF: 0.103

Gnomad4 EAS AF: 0.0929

Gnomad4 SAS AF: 0.0866

Gnomad4 FIN AF: 0.0549

Gnomad4 NFE AF: 0.0916

Gnomad4 OTH AF: 0.0813

ClinVar

Significance: Benign

Submissions summary: Benign:8

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:4

Benign, no assertion criteria provided	clinical testing	Genome Diagnostics Laboratory, University Medical Center Utrecht	-	- -
Benign, criteria provided, single submitter	clinical testing	Eurofins Ntd Llc (ga)	Aug 31, 2016	- -
Benign, criteria provided, single submitter	clinical testing	Genetic Services Laboratory, University of Chicago	Jun 18, 2020	- -
Benign, no assertion criteria provided	clinical testing	Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center	-	- -

not provided Benign:2

Benign, criteria provided, single submitter	clinical testing	GeneDx	Nov 03, 2019	- -
Likely benign, no assertion criteria provided	clinical testing	Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC)	-	- -

Androgen resistance syndrome;C1839259:Kennedy disease Benign:1

Benign, criteria provided, single submitter

clinical testing

Invitae

Jan 31, 2024

- -

Partial androgen insensitivity syndrome Benign:1

Benign, criteria provided, single submitter

clinical testing

Molecular Genetics, Royal Melbourne Hospital

May 04, 2023

European Non-Finnish population allele frequency is 10.38% (rs78686797, 364/3209 alleles, 0 homozygotes, 3 hemizygotes in gnomAD v2.1). Based on the classification scheme RMH Modified ACMG/AMP Guidelines v1.3.2, this variant is classified as BENIGN. Following criteria are met: BA1 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;