X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Position:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -1 ACMG points: 0P and 1B. BP6

The NM_000044.6(AR):​c.177_239dup​(p.Gln60_Gln80dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely benign (no stars).

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000085 (0 hom. 4 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 inframe_insertion
• Clinical Significance: Likely benign no assertion criteria provided B:1
• Conservation: PhyloP100: 0.337

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Likely_benign. Variant got -1 ACMG points.

• BP6: Variant X-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA is described in ClinVar as [Likely_benign]. Clinvar id is 3355844.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AR	NM_000044.6	c.177_239dup	p.Gln60_Gln80dup	inframe_insertion	1/8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.177_239dup	p.Gln60_Gln80dup	inframe_insertion	1/8	1	NM_000044.6	ENSP00000363822	P1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000853 AC: 8 AN: 937336 Hom.: 0 Cov.: 40 AF XY: 0.0000135 AC XY: 4 AN XY: 295426

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.0000553

Gnomad4 NFE exome AF: 0.00000834

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: no assertion criteria provided

Submissions by phenotype

AR-related disorder Benign:1

Likely benign, no assertion criteria provided

clinical testing

PreventionGenetics, part of Exact Sciences

May 01, 2024

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;