X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCA

Variant names:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T
• rs3032358
• NM_000044.6:c.192_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP3 BS2_Supporting

The NM_000044.6(AR):​c.192_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln65_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000448 in 1,003,954 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 11 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00020 (0 hom., 2 hem., cov: 0)
  • Exomes 𝑓: 0.000034 (0 hom. 9 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.40
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BS2: High Hemizygotes in GnomAd4 at 2 XL geneVariant has number of hemizygotes lower than other variant known as pathogenic in the gene, so the strength is limited to Supporting.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.192_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln65_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.192_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln65_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.000195 AC: 13 AN: 66636 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000106

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000317

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000341 AC: 32 AN: 937331 Hom.: 0 AF XY: 0.0000305 AC XY: 9 AN XY: 295421

African (AFR) AF: 0.0000421 AC: 1 AN: 23762

American (AMR) AF: 0.0000773 AC: 2 AN: 25862

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16268

East Asian (EAS) AF: 0.0000352 AC: 1 AN: 28387

South Asian (SAS) AF: 0.0000221 AC: 1 AN: 45250

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 36191

Middle Eastern (MID) AF: 0.000770 AC: 2 AN: 2596

European-Non Finnish (NFE) AF: 0.0000264 AC: 19 AN: 719113

Other (OTH) AF: 0.000150 AC: 6 AN: 39902

GnomAD4 genome AF: 0.000195 AC: 13 AN: 66623 Hom.: 0 Cov.: 0 AF XY: 0.000242 AC XY: 2 AN XY: 8259

African (AFR) AF: 0.000106 AC: 2 AN: 18799

American (AMR) AF: 0.00 AC: 0 AN: 5236

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 1715

East Asian (EAS) AF: 0.00 AC: 0 AN: 1843

South Asian (SAS) AF: 0.00 AC: 0 AN: 901

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 2025

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 133

European-Non Finnish (NFE) AF: 0.000317 AC: 11 AN: 34713

Other (OTH) AF: 0.00 AC: 0 AN: 812

Alfa AF: 0.00 Hom.: 237

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;