X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T
• rs3032358
• NM_000044.6:c.201_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_000044.6(AR):​c.201_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln68_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00018 in 1,003,943 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 49 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q67Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0011 (0 hom., 18 hem., cov: 0)
  • Exomes 𝑓: 0.00012 (0 hom. 31 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.40
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BS2: High Hemizygotes in GnomAd4 at 18 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.201_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln68_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.201_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln68_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.00107 AC: 71 AN: 66633 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00277

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000191

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000494

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000490

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000117 AC: 110 AN: 937323 Hom.: 0 AF XY: 0.000105 AC XY: 31 AN XY: 295413

African (AFR) AF: 0.000589 AC: 14 AN: 23761

American (AMR) AF: 0.000271 AC: 7 AN: 25861

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16269

East Asian (EAS) AF: 0.0000705 AC: 2 AN: 28387

South Asian (SAS) AF: 0.000199 AC: 9 AN: 45248

European-Finnish (FIN) AF: 0.0000276 AC: 1 AN: 36191

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2596

European-Non Finnish (NFE) AF: 0.0000904 AC: 65 AN: 719109

Other (OTH) AF: 0.000301 AC: 12 AN: 39901

GnomAD4 genome AF: 0.00107 AC: 71 AN: 66620 Hom.: 0 Cov.: 0 AF XY: 0.00218 AC XY: 18 AN XY: 8258

African (AFR) AF: 0.00277 AC: 52 AN: 18798

American (AMR) AF: 0.000191 AC: 1 AN: 5236

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 1715

East Asian (EAS) AF: 0.00 AC: 0 AN: 1843

South Asian (SAS) AF: 0.00 AC: 0 AN: 901

European-Finnish (FIN) AF: 0.000494 AC: 1 AN: 2025

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 133

European-Non Finnish (NFE) AF: 0.000490 AC: 17 AN: 34711

Other (OTH) AF: 0.00 AC: 0 AN: 812

Alfa AF: 0.00 Hom.: 237

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=183/17	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;