chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T

Position:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_000044.6(AR):​c.201_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln68_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00018 in 1,003,943 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 49 hemizygotes in GnomAD. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0011 (0 hom., 18 hem., cov: 0)
  • Exomes 𝑓: 0.00012 (0 hom. 31 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.40

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High Hemizygotes in GnomAd4 at 18 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AR	NM_000044.6	c.201_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln68_Gln80del	disruptive_inframe_deletion	1/8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.201_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln68_Gln80del	disruptive_inframe_deletion	1/8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.00107 AC: 71 AN: 66633 Hom.: 0 Cov.: 0 AF XY: 0.00218 AC XY: 18 AN XY: 8245

Gnomad AFR AF: 0.00277

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000191

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000494

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000490

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000117 AC: 110 AN: 937323 Hom.: 0 AF XY: 0.000105 AC XY: 31 AN XY: 295413

Gnomad4 AFR exome AF: 0.000589

Gnomad4 AMR exome AF: 0.000271

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000705

Gnomad4 SAS exome AF: 0.000199

Gnomad4 FIN exome AF: 0.0000276

Gnomad4 NFE exome AF: 0.0000904

Gnomad4 OTH exome AF: 0.000301

GnomAD4 genome AF: 0.00107 AC: 71 AN: 66620 Hom.: 0 Cov.: 0 AF XY: 0.00218 AC XY: 18 AN XY: 8258

Gnomad4 AFR AF: 0.00277

Gnomad4 AMR AF: 0.000191

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000494

Gnomad4 NFE AF: 0.000490

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;