X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCA-T
• rs3032358
• NM_000044.6:c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BS1 BS2

The NM_000044.6(AR):​c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln72_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000982 in 1,003,367 control chromosomes in the GnomAD database, including 7 homozygotes. There are 196 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0048 (6 hom., 46 hem., cov: 0)
  • Exomes 𝑓: 0.00071 (1 hom. 150 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 1.40
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Laboratory for Molecular Medicine, G2P
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, G2P
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BP6: Variant X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCA-T is Benign according to our data. Variant chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCA-T is described in ClinVar as Likely_benign. ClinVar VariationId is 516217.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.00476 (317/66621) while in subpopulation AFR AF = 0.00883 (166/18797). AF 95% confidence interval is 0.00773. There are 6 homozygotes in GnomAd4. There are 46 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 6 XL gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000044.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	NM_000044.6	MANE Select	c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	NP_000035.2
	AR	NM_001348063.1		c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80del	disruptive_inframe_deletion	Exon 1 of 4	NP_001334992.1	Q9NUA2
	AR	NM_001348061.1		c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80del	disruptive_inframe_deletion	Exon 1 of 4	NP_001334990.1	Q9NUA2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	ENST00000374690.9	TSL:1 MANE Select	c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENSP00000363822.3	P10275-1
	AR	ENST00000396044.8	TSL:1	c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80del	disruptive_inframe_deletion	Exon 1 of 5	ENSP00000379359.3	F5GZG9
	AR	ENST00000504326.5	TSL:1	c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80del	disruptive_inframe_deletion	Exon 1 of 4	ENSP00000421155.1	P10275-3

Frequencies

GnomAD3 genomes AF: 0.00477 AC: 318 AN: 66634 Hom.: 6 Cov.: 0

Gnomad AFR AF: 0.00889

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00803

Gnomad ASJ AF: 0.0187

Gnomad EAS AF: 0.00216

Gnomad SAS AF: 0.00219

Gnomad FIN AF: 0.00247

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00184

Gnomad OTH AF: 0.00249

GnomAD4 exome AF: 0.000713 AC: 668 AN: 936746 Hom.: 1 AF XY: 0.000509 AC XY: 150 AN XY: 294850

African (AFR) AF: 0.00295 AC: 70 AN: 23714

American (AMR) AF: 0.00108 AC: 28 AN: 25845

Ashkenazi Jewish (ASJ) AF: 0.00806 AC: 131 AN: 16244

East Asian (EAS) AF: 0.000846 AC: 24 AN: 28377

South Asian (SAS) AF: 0.000555 AC: 25 AN: 45032

European-Finnish (FIN) AF: 0.00182 AC: 66 AN: 36169

Middle Eastern (MID) AF: 0.000771 AC: 2 AN: 2593

European-Non Finnish (NFE) AF: 0.000360 AC: 259 AN: 718906

Other (OTH) AF: 0.00158 AC: 63 AN: 39866

GnomAD4 genome AF: 0.00476 AC: 317 AN: 66621 Hom.: 6 Cov.: 0 AF XY: 0.00557 AC XY: 46 AN XY: 8259

African (AFR) AF: 0.00883 AC: 166 AN: 18797

American (AMR) AF: 0.00802 AC: 42 AN: 5236

Ashkenazi Jewish (ASJ) AF: 0.0187 AC: 32 AN: 1715

East Asian (EAS) AF: 0.00217 AC: 4 AN: 1843

South Asian (SAS) AF: 0.00222 AC: 2 AN: 901

European-Finnish (FIN) AF: 0.00247 AC: 5 AN: 2025

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 133

European-Non Finnish (NFE) AF: 0.00184 AC: 64 AN: 34713

Other (OTH) AF: 0.00246 AC: 2 AN: 812

Alfa AF: 0.00 Hom.: 237

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not specified (2)
-	-	1	Androgen resistance syndrome;C0268301:Partial androgen insensitivity syndrome;C0376358:Prostate cancer;C1839259:Kennedy disease;C2678098:Hypospadias 1, X-linked (1)
-	-	1	AR-related disorder (1)
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=187/13	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs3032358;

hg19: chrX-66765158;

COSMIC: COSV65952641;