chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCA-T

Variant names:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCA-T
• rs3032358
• NM_000044.6:c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_000044.6(AR):​c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln72_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000982 in 1,003,367 control chromosomes in the GnomAD database, including 7 homozygotes. There are 196 hemizygotes in GnomAD. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0048 (6 hom., 46 hem., cov: 0)
  • Exomes 𝑓: 0.00071 (1 hom. 150 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 1.40

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCA-T is Benign according to our data. Variant chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCA-T is described in ClinVar as [Likely_benign]. Clinvar id is 516217.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00476 (317/66621) while in subpopulation AFR AF= 0.00883 (166/18797). AF 95% confidence interval is 0.00773. There are 6 homozygotes in gnomad4. There are 46 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 6 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.213_239delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.00477 AC: 318 AN: 66634 Hom.: 6 Cov.: 0 AF XY: 0.00558 AC XY: 46 AN XY: 8246

Gnomad AFR AF: 0.00889

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00803

Gnomad ASJ AF: 0.0187

Gnomad EAS AF: 0.00216

Gnomad SAS AF: 0.00219

Gnomad FIN AF: 0.00247

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00184

Gnomad OTH AF: 0.00249

GnomAD4 exome AF: 0.000713 AC: 668 AN: 936746 Hom.: 1 AF XY: 0.000509 AC XY: 150 AN XY: 294850

Gnomad4 AFR exome AF: 0.00295

Gnomad4 AMR exome AF: 0.00108

Gnomad4 ASJ exome AF: 0.00806

Gnomad4 EAS exome AF: 0.000846

Gnomad4 SAS exome AF: 0.000555

Gnomad4 FIN exome AF: 0.00182

Gnomad4 NFE exome AF: 0.000360

Gnomad4 OTH exome AF: 0.00158

GnomAD4 genome AF: 0.00476 AC: 317 AN: 66621 Hom.: 6 Cov.: 0 AF XY: 0.00557 AC XY: 46 AN XY: 8259

Gnomad4 AFR AF: 0.00883

Gnomad4 AMR AF: 0.00802

Gnomad4 ASJ AF: 0.0187

Gnomad4 EAS AF: 0.00217

Gnomad4 SAS AF: 0.00222

Gnomad4 FIN AF: 0.00247

Gnomad4 NFE AF: 0.00184

Gnomad4 OTH AF: 0.00246

ClinVar

Significance: Likely benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Feb 19, 2018

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

not provided Benign:1

Jul 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

AR: BS2 -

Androgen resistance syndrome;C0268301:Partial androgen insensitivity syndrome;C0376358:Malignant tumor of prostate;C1839259:Kennedy disease;C2678098:Hypospadias 1, X-linked Benign:1

Jul 31, 2021

Fulgent Genetics, Fulgent Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

AR-related disorder Benign:1

Sep 29, 2021

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;