X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCA
• rs3032358
• NM_000044.6:c.216_239dupGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3 BP6_Very_Strong BS2

The NM_000044.6(AR):​c.216_239dupGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln73_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0035 (7 hom., 13 hem., cov: 0)
  • Exomes 𝑓: 0.0013 (0 hom. 75 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 0.337
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -13 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BP6: Variant X-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCA is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 464794.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAd4 at 7 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.216_239dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln73_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.216_239dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln73_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.00347 AC: 231 AN: 66631 Hom.: 7 Cov.: 0

Gnomad AFR AF: 0.00149

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00459

Gnomad ASJ AF: 0.0227

Gnomad EAS AF: 0.00432

Gnomad SAS AF: 0.00548

Gnomad FIN AF: 0.00346

Gnomad MID AF: 0.00654

Gnomad NFE AF: 0.00337

Gnomad OTH AF: 0.00249

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00132 AC: 1232 AN: 936378 Hom.: 0 Cov.: 40 AF XY: 0.000255 AC XY: 75 AN XY: 294596

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000631 AC: 15 AN: 23753

American (AMR) AF: 0.00201 AC: 52 AN: 25823

Ashkenazi Jewish (ASJ) AF: 0.00884 AC: 143 AN: 16184

East Asian (EAS) AF: 0.00396 AC: 112 AN: 28294

South Asian (SAS) AF: 0.00164 AC: 74 AN: 45095

European-Finnish (FIN) AF: 0.00279 AC: 101 AN: 36149

Middle Eastern (MID) AF: 0.00116 AC: 3 AN: 2594

European-Non Finnish (NFE) AF: 0.000896 AC: 644 AN: 718635

Other (OTH) AF: 0.00221 AC: 88 AN: 39851

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00345 AC: 230 AN: 66618 Hom.: 7 Cov.: 0 AF XY: 0.00157 AC XY: 13 AN XY: 8258

African (AFR) AF: 0.00149 AC: 28 AN: 18797

American (AMR) AF: 0.00458 AC: 24 AN: 5236

Ashkenazi Jewish (ASJ) AF: 0.0227 AC: 39 AN: 1715

East Asian (EAS) AF: 0.00434 AC: 8 AN: 1843

South Asian (SAS) AF: 0.00555 AC: 5 AN: 901

European-Finnish (FIN) AF: 0.00346 AC: 7 AN: 2025

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 133

European-Non Finnish (NFE) AF: 0.00337 AC: 117 AN: 34710

Other (OTH) AF: 0.00246 AC: 2 AN: 812

Alfa AF: 0.00 Hom.: 237

Bravo AF: 0.0000416

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Oct 31, 2017

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Androgen resistance syndrome;C1839259:Kennedy disease Benign:1

Jan 20, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.34
Mutation Taster		=69/31	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;