X-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001399.5(EDA):c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC(p.Pro188ArgfsTer83) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P188P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001399.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- tooth agenesis, selective, X-linked, 1Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- X-linked hypohidrotic ectodermal dysplasiaInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae)
- tooth agenesisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 21
GnomAD4 genome Cov.: 21
ClinVar
Submissions by phenotype
Hypohidrotic X-linked ectodermal dysplasia Pathogenic:1
The Pro188fs variant (EDA) has been reported as a de novo variant in one individ ual with X-linked hypohidrotic ectodermal dysplasia (Monreal 1998). This framesh ift variant is predicted to alter the protein?s amino acid sequence beginning at position 188 and lead to a premature termination codon 83 amino acids downstrea m. This alteration is then predicted to lead to a truncated or absent protein. L oss of function of the EDA gene is an established disease mechanism in X-linked hypohidrotic ectodermal dysplasia. In summary, this variant meets our criteria t o be classified as pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at